16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe

Answers

Answer 1

The phenotype is affected by mutations 1 and 2 because in the first, the complete protein is altered, and in the second, the new amino acid may cause the protein to have altered or no function.

What is Mutation?

Mutations can happen naturally or as a result of UV rays, congenital conditions, ionic radiations, or specific free radicals.

Even with the point mutation, there is no alteration to the amino acid sequence, hence the protein will not be affected.

In mutation 1, a new nucleotide is added at codon 9, changing the whole sequence of amino acids and codons in the process,  mutation frameshift.

Because a new codon was created as a result of the substitution of one nucleotide by another in mutation 2, produced a new amino acid, so Point mutation.

Therefore, in mutation 3, one nucleotide is swapped out for another, and the resulting codon codes the same amino acid as the one before it, so point mutation.

Learn more about mutation, here:

https://brainly.com/question/17130462

#SPJ4


Related Questions

Approximately _______ percent of men are color blind (and thus improper use of color can impair their ability to read information)

Answers

Answer: 8%

Explanation: Color blindness affects 1 in 12 men which is 8%.

Mollusks live in many marine and freshwater environments and are also common on land but most are [blank]

Answers

Mollusks live in many marine and freshwater environments and are also common on land but most are in oceans.

What is meant by the term mollusks?

The term " mollusks " is used to describe group of invertebrate animals with unsegmented bodies.

That being said, these group of invertebrate animals are characterized by some of the following features below:

The body of mollusks is covered by a calcareous shell.

Mollusks possess a cavity.They are freshwater animalsThey are also found in oceans.

In conclusion, it can be deduced from the explanation given above that the cavity found in the mollusks are used for excretion and respiration.

Read more on mollusks:

https://brainly.com/question/12184040

#SPJ1

How are proteins made using the information found in the DNA?

Answers

The sandwich-like arrangement of ribosomal subunits on the strand of mRNA that occurs during translation allows them to draw in tRNA molecules bound to amino acids (circles). The ribosome transforms the decoded mRNA sequence into a polypeptide, or new protein, into a lengthy chain of amino acids.

Ribosomes are located where?

Depending on whether the cell is from a plant, an animal, or a bacterium, ribosomes are usually found attached to the endoplasmic reticulum and the nuclear envelope, as well as freely dispersed throughout the cytoplasm.

For the purpose of protein synthesis, the mRNA is produced in the nucleus and moved to the cytoplasm. In the cytoplasm, mRNA polymers are wrapped with the ribosomal subunits. Proteins are then created by the tRNA. The building of proteins occurs on ribosomes.

learn more about Proteins refer

brainly.com/question/10058019

#SPJ4

Why did the F1 generation showed all flowers to be purple rather than a mix of white and purple flowers?

Answers

Purple flowers were only seen in the F1 generation because the purple gene was dominant and all of the offspring included that gene so they were purple.

The laws of dominance and segregation are the two genetic mechanisms responsible for this. 

Law of dominance :- One allele manifests itself in the F1 generation and blocks the expression of the other allele, in accordance with the Law of Dominance. The dominant allele is known as the expressing allele, while the recessive allele is known as the non-expressing allele.

Law of segregation:- A gamete only acquires one of the two alleles in accordance with the Law of Segregation, which states that two alleles of a gene remain together but segregate from one another during gamete production.

As a result, the F1 generation showed evidence of purple's dominance over white. These F1 plants produced purple and white flowers in a 3:1 phenotypic ratio after being selfed.

know more about alleles here

https://brainly.com/question/7602134#

#SPJ4

DNA replication is a necessary process associated with the cell cycle. Which of the following statements best identifies when DNA replication occurs and why it is important.


a) during cell division, to ensure that the DNA will fit into the resulting cells


b) after a cell divides, to provide each of the two resulting cells with a complete set of DNA instructions


c) before a cell divides, to provide each of the two resulting cells with a complete set of DNA instructions​

Answers

The statement that best identifies when DNA replication occurs and why it is important is as follows: before a cell divides, to provide each of the two resulting cells with a complete set of DNA instructions (option C).

What is DNA replication?

DNA replication is the process by which DNA makes a copy of itself during cell division.

DNA replication occurs during the interphase stage of cell division, specifically in the synthesis (S) phase.

The first step in DNA replication is to ‘unzip’ the double helix structure of the DNA molecule. This is carried out by an enzyme called helicase which breaks the hydrogen bonds holding the complementary bases of DNA together (A with T, C with G).

The separation of the two single strands of DNA creates a ‘Y’ shape called a replication ‘fork’. The two separated strands will act as templates for making the new strands of DNA.

Replication of DNA is an essential process because, whenever a cell divides, the two new daughter cells must contain the same genetic information, or DNA, as the parent cell.

Therefore, option C is the correct answer.

Learn more about DNA replication at: https://brainly.com/question/16464230

#SPJ1

Why are cells the basic unit of structure?

Answers

Cells are the unit of structure as they form the structure of organisms. Organisms combine to form tissues, which further combine to form organs, organs combine to form organ systems, which further combine to form organisms. Thus, the cell is the basic unit of structure for all unicellular and multicellular organisms.

"A cell is defined as the smallest and the basic unit of life which  is responsible for all processes of life."

Cells are the structural, functional, as well as  biological units of all living things. A cell can replicate itself. Therefore, they are known as the building blocks of life.

Every cell contains a fluid called cytoplasm, which is covered by a membrane. Also, in the cytoplasm there are many biomolecules such as proteins, nucleic acids and lipids. Additionally, cellular structures called cell organelles are suspended in the cytoplasm.

Characteristics of Cells

The following are the types of important characteristics of cells:

Cells provide structure and support to the organism's body.The interior of the cell is organized into different organelles surrounded by a separate membrane.The nucleus (the main organelle) holds the genetic information necessary for cell reproduction and growth.Each cell has a single nucleus and membrane-bound cells in the cytoplasm.Mitochondria, a double-membrane-bound cell is responsible for the energy transfer necessary for cell survival.Lysosomes digest unwanted material in the cell.Endoplasmic reticulum plays an important role in the internal structure of the cell by combining selected molecules and processing them, guiding and distributing them to the right places.

For more such questions on Cell:

https://brainly.com/question/3142913

#SPJ4

The insulin receptor is a transmembrane protein that plays a role in the regulation of glucose homeostasis. The receptor’s extracellular domain binds specifically to the peptide hormone insulin. The receptor’s intracellular domain interacts with cellular factors. The binding of insulin to the receptor stimulates a signal transduction pathway that results in the subcellular translocation of GLUT4, a glucose transport protein that is stored in vesicles inside the cell. A simplified model of the insulin receptor–signaling pathway is shown in Figure 1.
Which of the following statements best predicts the effect of a loss of function of the insulin receptor’s intracellular domain?
answer choices
The stimulation of the signal transduction pathway will increase.
The storage of GLUT4 in vesicles inside the cell will increase.
The number of GLUT4 molecules in the plasma membrane will increase.
The concentration of glucose inside the cell will increase.

Answers

Statement B. the storage of GLUT4 in vesicles inside the cell will increase best predicts the effect of a loss of function of the insulin receptor’s intracellular domain.

What is the insulin receptor’s intracellular domain?

The insulin receptor’s intracellular domain denotes the internal part of the receptor protein located in the internal surface of the cell that surrounds the cytoplasm, which is able to bind insulin hormone during glucose metabolism.

Therefore, with this data, we can see that the insulin receptor’s intracellular domain is able to respond to environmental stimuli such as the concentration of glucose.

Learn more about intracellular domains here:

https://brainly.com/question/14457215

#SPJ1

What is the most important part of prenatal care?

Answers

It is possible to lessen the risk of complications during pregnancy and support the health and development of the fetus by eating a nutritious, safe diet, exercising regularly as directed by a healthcare professional, and avoiding exposure to radiation and lead.

What aspect of prenatal care is most crucial? It is possible to lessen the risk of complications during pregnancy and support the health and development of the fetus by eating a nutritious, safe diet, exercising regularly as directed by a healthcare professional, and avoiding exposure to radiation and lead.Pregnancy and birth issues are less likely if you receive regular prenatal care throughout your whole pregnancy.Schedule a consultation with your OB/Gyn as soon as you suspect you are expecting.Don't smoke or use alcohol if you want to keep yourself and your unborn child healthy.Get adequate folic acid and maintain a healthy diet.Continue to move your body.

To learn more about prenatal care refer

https://brainly.com/question/1183395

#SPJ4

How long does it take snails to mature?

Answers

The eggs hatch in 14 to 30 days, releasing snails. These snails grow up and after 6 months, the snails are mature. Sexual maturity takes up to 6 to 16 months, depending on weather and availability of calcium.

How long does snails take to mature?

Snails are hermaphrodites which implies that they have both male and female reproductive organs. Even though snails are able to self-fertilize, most snails will mate with another snail. The garden snail reaches to sexual maturity between one to two years after hatching.

When snails are sexually mature that is between 8 to 12 months after hatching, then they lay eggs that hatch between 4 and 6 weeks.

To know more about snails, refer

https://brainly.com/question/29933242

#SPJ4

increased fluid in inflamed gingival tissue can cause the tissue to be characterized by: group of answer choices a) soft, spongy, and nonelastic tissue b) firm and fibrotic tissue c) tissue that is red to purplish-red in color d) gingival tissue with blunted papillae

Answers

The increased fluid in inflamed gingival tissue can cause the tissue to be characterized by A. Soft, spongy, and non-elastic tissue

What is the tissue?

The soft tissues that cover the alveolar bone of the jaws and the teeth up to the exposed crowns of the teeth are known as the gingival tissues or gingiva.

The connective tissue fibers in the gingival tissue next to the teeth are called gingival fibers. They support the gums' ability to adhere tightly to the teeth. Although type III fibers are also present, type I collagen makes up the majority of them. The tooth is joined to the gingival tissue by these fibers.

Learn more about tissue on:

https://brainly.com/question/13253399

#SPJ1

christians are equipped with both natural abilities and _________ gifts.

Answers

Spiritual gifts. You receive Jesus when you rely on Him and accept Him as your Savior. Second, in order to convey the life of the natural dwelling Christ, God imparted His Spirit to the elect.

Jesus bought us back so that we may be adopted as sons. Natural talents are skills that one is born with and develops within the setting of their family. We all know folks who are gifted and who have a long line of ancestors who are also gifted. The seven gifts of the Holy Spirit are a list of seven spiritual talents that may be found in the book of Isaiah for the first time and have been extensively discussed by patristic writers. They are knowledge, courage, fortitude, piety, fear of the Lord, and wisdom.

Learn more about Natural

https://brainly.com/question/9830102

#SPJ4

Why does pure water have a neutral pH?

Answers

The reason why Pure water has Neutral pH is that it ALWAYS will have the same the same number of hydrogen ions and hydroxide ions, making it never a negative or a positive. If however, it did have a different balance, it would be no different.

The water will still be neutral no matter what, even if its pH changes (like the 2nd common one, pOH)

The water will be neutral no matter what

What are the ethical barriers to research on women who are pregnant?

Answers

Several factors must be considered before pregnant women are excluded, including whether extrapolated knowledge from trials with pregnant animals and nonpregnant humans is available.

What are the ethical dilemmas in the care of pregnant women?An ethical conundrum may arise for a doctor when a pregnant woman exhibits behavior(s) that could be damaging to her developing fetus or rejects a suggested diagnostic or therapeutic intervention intended to improve fetal health and well-being. Particularly complicated scientific, moral, and legal issues arise while researching pregnant women. Within and between the mother's body, the placenta, and the fetus, pregnancy's physiology undergoes significant changes during the course of the many weeks, months, and trimesters. While trade-offs between maternal and fetal risks and benefits can pose challenging study design issues, they do not by themselves constitute a justification for excluding pregnant participants.Before pregnant women are excluded, a number of factors must be taken into account, such as the availability of extrapolated knowledge from trials with pregnant animals and non-pregnant humans, whether the study has the potential to directly benefit the woman, her fetus, or both, and whether the risks of inclusion have already been distinctly identified and minimized.

To learn more about ethical conundrum refer to:

https://brainly.com/question/30031641

#SPJ4

Is Sweating an example of homeostasis?

Answers

Homeostasis is defined as the regulation of biological systems such as temperature, blood pressure, etc., in response to changing environmental conditions. Sweating is an example of homeostasis as it helps regulate our body temperature. When our core temperature rises, we start to sweat.

In biology, homeostasis (British also homoeostasis) is the state of steady internal, physical, and chemical conditions maintained by living systems This is the condition of optimal functioning for the organism and includes many variables, such as body temperature and fluid balance, being kept within certain pre-set limits (homeostatic range).

Other variables include the pH of extracellular fluid, the concentrations of sodium, potassium and calcium ions, as well as that of the blood sugar level, and these need to be regulated despite changes in the environment, diet, or level of activity. Each of these variables is controlled by one or more regulators or homeostatic mechanisms, which together maintain life

Learn more about homeostasis to visit this link

https://brainly.com/question/12221049

#SPJ4

What is the basic difference between asexual and sexual reproduction?

Answers

Asexual and sexual reproduction are two distinct ways in which organisms reproduce. Asexual reproduction is the production of offspring from a single parent, while sexual reproduction requires two parents to produce offspring.

Asexual reproduction is much simpler than sexual reproduction and can occur in many different ways. In some species, such as bacteria, a single parent can divide into two parts, each of which develops into a new organism.

The major difference between asexual and sexual reproduction is that asexual reproduction produces offspring that are genetically identical to the parent, while sexual reproduction produces offspring that are genetically unique. This is because sexual reproduction combines the genetic materials of two parents, while asexual reproduction does not.

Learn more about sexual reproduction at :https://brainly.com/question/7464705

#SPJ4

Is blood An example of homeostasis?

Answers

By regulating pH, temperature, osmotic pressure, and heat production, blood supports homeostasis. By delivering nutrients and hormones and eliminating waste, blood promotes development. Hemoglobin, an oxygen-binding protein, is found in red blood cells.

What component of the blood keeps everything balanced?

The body's blood vessels, including arteries, veins, and capillaries, have the ability to dilate and constrict in order to maintain homeostasis. The body's sensors detect an increase in core temperature, and when they do, blood vessels widen to let more blood through, which releases the extra heat.

RBC homeostasis is regulated by interactions between proteins in and associated with the plasma membrane. These interactions revolve around band 3.

Learn more about homeostasis to visit this link

https://brainly.com/question/3888340

#SPJ4

19. What is active transport? 11. What type of organic molecule is needed for active transport? 12. What is endocytosis and exocytosis? 13. What is the difference between diffusion and active transport? 14. Once materials diffuse into a cell, what happens?​

Answers

Answer:

19. Active transport is a process by which cells move molecules or ions across their membranes against a concentration gradient, using energy from ATP.

11. The type of organic molecule needed for active transport is ATP (adenosine triphosphate), which provides the energy required to move molecules or ions against a concentration gradient.

12. Endocytosis is a process by which cells take in molecules or particles from the outside environment, by engulfing them in a vesicle. Exocytosis is the opposite process, by which cells release molecules or particles from inside the cell to the outside environment.

13. The main difference between diffusion and active transport is that diffusion is a passive process that does not require energy, whereas active transport requires energy from ATP to move molecules or ions against a concentration gradient.

14. Once materials diffuse into a cell, they can enter the cell's metabolic pathways and be used for various cellular processes, such as energy production or the synthesis of new molecules. Alternatively, they can be stored inside the cell for later use.

Answer:

Active transport is a process by which cells move molecules across their membranes against a concentration gradient, using energy from ATP (adenosine triphosphate). This means that the cell is moving molecules from an area of lower concentration to an area of higher concentration, which is the opposite of what happens in diffusion.
Active transport requires the use of specialized protein molecules called transport proteins, which are embedded in the cell membrane. These proteins bind to the molecules being transported and move them across the membrane using energy from ATP.
Endocytosis is the process by which a cell takes in molecules from its environment by forming a pocket or vesicle around them. This can happen in several ways, including phagocytosis (where the cell engulfs the molecules) and pinocytosis (where the cell forms vesicles around droplets of fluid).

Exocytosis is the opposite of endocytosis, and is the process by which a cell releases molecules from inside the cell to the outside environment. This is typically done by forming a vesicle around the molecules and then fusing the vesicle with the cell membrane, allowing the molecules to be released.
The main difference between diffusion and active transport is that diffusion is a passive process that does not require energy, while active transport is an active process that requires energy. Diffusion occurs naturally and spontaneously, moving molecules from an area of higher concentration to an area of lower concentration. In contrast, active transport moves molecules against their concentration gradient, requiring the cell to use energy from ATP to do so.
Once materials diffuse into a cell, they are either used by the cell for its own metabolic processes, or they are stored for later use. Some molecules may also be transported to other parts of the cell or to other cells, depending on the needs of the organism.

dna is a self-replicating molecule. what accounts for this important property of dna? a the nitrogenous bases of the double helix are paired in specific combinations: a with t and g with c. b replication is thermodynamically spontaneous and requires no enzymes. c its two strands are held together by easily broken covalent bonds.

Answers

a The nitrogenous bases of the double helix are paired in specific combinations: A with T and G with C.

What causes DNA to replicate itself?

DNA is indeed a self-replicating molecule whose nucleotide constituents interact chemically in precise ways that enable the creation of self-assembled structures.DNA replication requires proteins in living systems.

What characteristic of DNA causes it to replicate?

DNA replication is predominantly carried out by the polymerase enzyme DNA Pol III in E. coli.At the replication fork, it forms a replication complex with extraordinarily high processivity that endures the whole replication cycle.

To know more about self-replicating molecule visit:

https://brainly.com/question/14723456

#SPJ4

why can swabbing items such as keyboards, computer mice, pens, and phones provide an accurate representation of microbes living in association with humans? a. the items such as keyboards, pens, phones, and others provide a great growth resource for microbes. b. microbes that naturally live on these surfaces survive better due to oils released from human skin. c. certain microbes live on the surface of the skin, and humans shed their skin cells fairly frequently. d. microbes that naturally live on these surfaces survive better due to sugars found on human skin. e. the items such as keyboards, pens, phones, and others provide a sterile growth resource for microbes, improving the accuracy of the swabs.

Answers

certain microbes live on the surface of the skin, and humans shed their skin cells fairly frequently.

What type of microbes live on the skin?Rod and round bacteria, such as Proteobacteria and Staphylococcus spp., respectively, create communities on the skin surface that are intricately entwined with one another and other microbes. Commensal fungi, like Malassezia spp., can develop both as individual cells and as branching filamentous hypha.For instance, researchers discovered that almost everyone regularly contains infections, or bacteria, known to cause disease. However, pathogens do not cause disease in healthy people; instead, they merely coexist with their host and the rest of the human microbiome, which is a collection of all the microorganisms found in the human body.

To learn more about microbes  refer,

https://brainly.com/question/8695285

#SPJ1

Does a virus have ribosomes?

Answers

Viruses are totally reliant on their biological hosts for energy production and protein synthesis because they lack ribosomes, mitochondria, or any other organelles.

A virus contains how many ribosomes?

The majority of viruses (>99%) only had one ribosomal protein gene (exception: 8 uncultivated viral contigs had two; Supplementary), which is obviously insufficient for viruses to assemble functioning ribosomes on their own.

Are there cytoplasm and ribosomes in viruses?

Viruses don't include any of the components you often associate with cells, despite the fact that some highly developed viruses appear to be fancy. They lack mitochondria, ribosomes, and nuclei. Even without cytoplasm, certain viruses exist.

To know more about ribosomes visit :-

https://brainly.com/question/241631

#SPJ4

The Punnett square is for a test cross of two mice that were purebred for two different traits. What will their offspring be? Fill in the white boxes of the Punnett square with all possible offspring genotypes

Answers

As per the statement there is no Punnett Square is provide hence can't be answered as per the given statement that is a test cross of two mice that were purebred for two different traits. What will their offspring be?

What is a Punnett Square? Punnett Square is a squared tool used in the biology to describe the genotypes of a particular cross done for developing off springs experimentally. Punnett Square provides us info to show all possible allelic combinations of gametes.it also facilitates the prediction of the percentages of phenotypes in the offspring of a cross done from a known genotypic parents.

To know more about Punnett Square visit

https://brainly.com/question/14513603

#SPJ1

when a fractured bone heals, it leaves a thickened region known as a __________.

Answers

When a fractured bone heals, it leaves a thickened region known as a callus.

Bone is the part of the skeletal system of the body. It is a thick mass of tissue that is hard on the outside but soft on the inside. The main function of the bones is to provide a structural framework and correct posture to the body.

Callus is the mass of soft tissues that is formed after the healing of the fracture. It is initially soft but becomes hard along with the time. The callus is the one responsible for keeping the broken bones together. The phase of healing where this callus formation takes place is called reparative phase.

To know more about bone, here

brainly.com/question/13608226

#SPJ4

What are the 4 steps of protein creation?

Answers

Each cell's intricate and strictly regulated process for translating genes into proteins. The two main procedures are transcription and translation. Expression of genes is the consequence of both transcription and translation processes.

How are proteins made, and in what order?

The creation of proteins adheres to the fundamental principles of molecular biology, which serve as the foundation for all the biological functions that occur in each and every cell of our body. The core dogma states that the transmission of information occurs in the order of DNA, RNA, then protein.

The procedure by which DNA is duplicated to create a corresponding strand of RNA is known as transcription. RNA is subsequently translated to produce proteins. Initiation and promoter are the two main phases of transcription.

learn more about protein creation refer

https://brainly.com/question/884041

#SPJ4

The respiratory system of an elephant functions in a similar way to which organelle.

Answers

The respiratory system of an elephant functions in a similar way to the plasma membrane.

The network of organs and tissues that aid in breathing is known as the respiratory system. It includes your lungs, blood vessels, and airways. The respiratory system also includes the muscles that power your lungs. In order to eliminate waste gases like carbon dioxide and move oxygen throughout the body, these components collaborate.

Animals' respiratory systems are involved in gas exchange. Oxygen is taken in and carbon dioxide and ATP molecules are released during animal respiration.

Similar to the elephant's respiratory system, the plasma membrane of a single-celled organism is involved in gas exchange with the outside.

Know more about respiratory system here: https://brainly.com/question/4190530

#SPJ4

Is arteriosclerosis the same as dementia?

Answers

Atherosclerosis can increase your risk of vascular dementia by reducing the influx of blood that nourishes your brain.

High cholesterol, Elevated situations of low- density lipoprotein( LDL), the" bad" cholesterol, are associated with an amplified threat of vascular dementia which are all cause by Atherosclerosis

Cerebral arteriosclerosis can bring about serious health problems. However, or a blood clot becomes caught in the narrow passage, blood inflow to the brain can become blocked and generate an, If the walls of an artery are too thick. When the thickening and hardening is uneven, arterial walls can develop bulges( called aneurysms). Atherosclerosis is a type of arteriosclerosis, which is any hardening of the arteries. Your arteries can become hard or stiff for numerous different reasons. One reason is plaque buildup.

For more information on Atherosclerosis , visit :

https://brainly.com/question/29626891

#SPJ4

Scientists place great confidence in cell theory, yet it has not been evaluated using every living thing on the planet. What piece of evidence would most likely cause scientists to decide that cell theory would need to be revised?.

Answers

Explanation:

A. An organism was found with tissues that contained no cells.

B. A cell was found that could continue to divide and reproduce endlessly.

C. An animal cell was found that could harness solar energy, similarly to plant cells.

D. A sample of cells was found that used something other than DNA as hereditary material.

Hierarchical organization and chemical complexity can be exemplified by the Saguaro desert as the ecosystem. Provide an example for each of the other six hierarchies leading up to this ecosystem.

Answers

The hierarchies could be: 1) Elements; C, N, O, H, etc., 2) Biomolecules; amino acids, nucleotides, simple sugars, etc., 3) Macromolecules; proteins, carbs, etc., 4) Metabolism; glycolysis, photosynthesis, Calvin Cycle, etc., 5) Cells; plant cells, muscle cells, liver cells, etc., 6) Organisms; saguaro cacti, javelinas, glia monster, etc., and 7) Sonoran desert.

I hope this helped and Merry Christmas!

What are the means of mechanoreception for hearing and balance?

Answers

Answer:

Explanation: Mechanoreception is the ability of an organism to sense and respond to physical stimuli. It is a type of sensory perception that allows organisms to sense mechanical forces such as pressure, touch, vibration, and movement.Mechanoreception in hearing is used to detect sound waves and vibrations. The auditory nerve sends signals to the brain, which it interprets as sound....

Five students design an experiment to answer the question:"how is heart rate affected by running?''Two chairs were set up at different ends of a large room.The pulse rate of each student was taken at rest just before running?"Each of the five students ran between the chairs a different number of times.Their pulse rates were taken after running and the results are shown in the table below.If a control group is not included in an experiment, it would be difficult to

Answers

Answer:

Without a control group, it is difficult to determine the effect of running on heart rate, as there may be other factors influencing the results. To accurately determine the effect of running on heart rate, it would be helpful to include a control group of individuals who do not run and to control for other variables that could potentially affect heart rate.

Explanation:

determine if the changes in heart rate were due to running or some other factor. A control group is a group of individuals or objects that serve as a reference point for comparison in an experiment. It helps to isolate the effect of the variable being tested (in this case, running) and helps to rule out the influence of other variables that could potentially affect the outcome.

Without a control group, it would be difficult to determine if the changes in heart rate were due solely to running or if there were other factors at play. For example, perhaps one of the students was feeling particularly anxious or stressed before running, which could have affected their heart rate. Or perhaps the room temperature or humidity were different for each student, which could also impact heart rate.

To improve the design of this experiment, it would be useful to include a control group of students who did not run at all. This would allow for a more accurate comparison of the effect of running on heart rate, as any changes in the control group could be attributed to factors other than running. It would also be helpful to control for other variables, such as room temperature and humidity, to further isolate the effect of running on heart rate.

Adding humus in a garden will most likely

Answers

Because humus contains important minerals like nitrogen and carbon, it significantly improves the fertility and overall health of the soil and, consequently, plant development. The carbon to nitrogen ratio in mush is 10 to 1.

The powerful, nutrient-rich result of organic materials' natural decay into non-living organic matter is called humus. It has a viscous, jelly-like texture and is a deep brown that almost looks black. Humus is produced by the full, organic decomposition of dead plant and animal materials and is typically found in the damp, rich soils of woodland regions. Humus develops in two main phases. Plant roots nearby can absorb inorganic substances like minerals and nutrients when organic garbage and plant debris decomposes. This earliest phase in soil science is alled “mineralization.”

Learn more about humus here

https://brainly.com/question/19831951

#SPJ4

Other Questions
The equation yk = a(xh) ^2 has graph a parabola with vertex (h, k).Suppose a > 0. A horizontal line 1 unit above the vertex intersects thegraph at two points. Find the distance between these two points. bramdpm owns nearly 2 times as many cds as ingrid.brandon owns 56 cds.write an equation and use it to estimate the number n of cds ingrid owns. Type the correct answer in the box. Spell all words correctly. Which act was enacted as a response to the rising level of unsecured consumer debt? the act was enacted as a response to the rising level of unsecured consumer debt. A two-part question....(i). Set up, but do not evaluate, a triple integral that gives the volume of the right circular cylinder enclosed by the surfaces x^2 + y^2 = 4 , z=-10 and z=0.(ii). Set up, but do not evaluate, a triple integral that gives the volumes of the right circular cylinder above with a hemisphere sitting atop the cylinder. The following graph shows a system of inequalities. Is the point (-4,-4) a solution to the system?Yes, the point is a solution.No, the point is not a solution. What type of government did Anti-Federalists favor quizlet? Look at this table:131519-19-9Is this relation a function?yesno What are the 8 classification of organisms? Classify each phrase based on the macronutrient it describes. Carbohydrates Proteins Lipids Water contains nitrogen cticial source of energy for the brain and red blood cells provides 9 kcal/g fills and surrounds every cell in the body dietary fiber deposits in body provide insulation and tection provides 0 kcal/g starch and sugar comprised of chains of amino acids olive oil Answer Bank In which of these substances are the atoms held together by polar covalent bonding?A) SrClB) CsClC) ClFD) TiFE) S Can pharmacist use DR with their name? What does it mean to apply a function? In the context of this passage, can you change your identity? how is ebenezer changed, if at all, in this chapter? is it possible for him to change his ways? cite evidence from this text, your own experience, and other literature, art, or history in your answer. How is a super PAC different from a PAC? ________ is a legal principle that ensures that previous judicial decisions are considered when settling similar future cases. A) Precedent B) Statutory law C) Tort D) Inchoate. What is an example of internal and external conflict? 36. which of the following is a major goal of the program begun in 1995 to reintroduce the gray wolf into yellowstone national park? Why does AAS congruence work? Could you please find X and show me how Is it true a 0 or 1? Steam Workshop Downloader