2x^2
When x is equal to -3

Answers

Answer 1

Answer:

18

Step-by-step explanation:

Substitute x = - 3 into the expression

2x²

= 2(- 3)²

= 2 × 9

= 18


Related Questions

12. Fancy goldfish x cost $3 each and
common goldfish y cost $1 each. Graph
the function y
20
3x to determine
how many
of each type of goldfish Tasha
can buy for $20.

Answers

Answer:

x (Fancy Gold fish) = 3

y (Common goldfish) = 29

Step-by-step explanation:

Fancy goldfish x cost $3 each

common goldfish y cost $1 each

Graph: y  = 20 +  3x (I'm hoping this is the correct line equation, please do leave a comment below if it's not)

Thus, we graph it by subtitude either the x or y values. (Or you can use just X = 1,2,3).

Now, to find how many of each type of goldfish Tasha can buy. We subtitude the line equation by either using x = 3 or y = 1

Using either values to solve the equation, we get:

x = 3

y = 29

Hope this helps!

PLLSSS HELP MEEEE!!

Is it possible for Bruce and Felicia to have used the same number of tiles? Use complete sentences to explain your reasoning.

Number of tiles Bruce used: 5x + 2
Number of tiles Felicia used: 5x + 5

Answers

Answer:

No it is not possible for Bruce and Felicia to have used the same number of tiles.

Step-by-step explanation:

Bruce would have used 10x of tiles and Felicia used 7x of tiles.

No, it is not possible that Bruce and Felicia to have used the same number of tiles

The expression which shows the difference is (n² - 2)/2n, the correct option is B.

What is an Expression?

An expression is a mathematical statement which consists of variables, constants and mathematical operators.

Number of tiles Bruce used: 5x + 2

Number of tiles Felicia used: 5x + 5

On equating the two expressions

5x+2 = 5x+5

There is no solution

At any value of x, Bruce would have always used 3 tiles less than Felicia.

To know more about Expression

https://brainly.com/question/14083225

#SPJ2

Solve the system of equations.
fequations with
on: potato chips
15x + 3y = -3
equations with
n: -3x-4y=-2 &
2 = -y +3
2=
stems of
with
Y =

Answers

Answer:

y = - 3, x = 6

Step-by-step explanation:

15x + 31y = - 3

x = - y + 3

15(- y + 3) + 31y = - 3

-15y + 45 + 31y = - 3

16y + 45 = - 3

16y = - 48

y = - 3

x = - (- 3) + 3

x = 3 + 3

x = 6

Answer:

x = 6, y = -3.

Step-by-step explanation:

15x + 31y = -3

x = -y + 3

Substitute x = -y + 3 in the first equation:

15(-y + 3) + 31y = -3

-15y + 45 + 31y = -3

16y = -3 - 45 =-48

y = -3.

So x = -(-3) + 3 = 6.

What is the domain and range of the function f(x)=17?

Answers

D: All Real Numbers R: [17,17]
First, rewrite as y=17. This will look like a horizontal line.

Domain is all x values represented. If the line is infinately horizontal, the domain is all real numbers

Range is all y values. The only y value is 17. So u can write range as y=17. I don’t know what the other dude was doin with brackets. It’s simply y=17

Malcolm took 18 minutes to do 15 math problems. Diedra took 17 minutes to do 16 math problems. Which student did more problems per minute?

Answers

The student that did more maths problems per minute is Diedra.

In order to determine which student did more maths problems per minute, the rate of each student has to be determined. Rate is the total questions solved divided by the time.

Rate = total questions / total time

Malcolm = 15 / 18 = 0.833 problems per minute

Diedra = 16/ 17 = 0.941 problems per minute

To learn more about rate, please check: brainly.com/question/9834403

compare:
1. 4 3/8 (__) 4 7/10
2. 3/10 (__) 25/100
3. 5/8 (__) 3/5
4. 8/12 (__) 6/9
Help me please, and thx for the help

Answers

1. > 7/10 = 70% and is more than 3/8.
2.> 3/10 is equal to 30% which is more than 25%
3. > 5/8 is equal to 25/40 and 3/5 is equal to 24/40
4. = 8/12 is equal to 72/108 and 6/7 is equal to 72/ 108 too

1) 4 3/8 < 4 7/10

2) 3/10 > 25/100

3) 5/8 > 3/5

4) 8/12 = 6/9

hope this is helpful!

I really really really need help with this

Answers

Answer:

404

Step-by-step explanation:

PEMDAS48 ÷ 6 + (5×6) × 13 + 6 =            → Parenthesis48 ÷ 6 + 30 × 13 + 6 =                → Multiplication, division8 + 390 + 6 =                              → Addition404

[tex]\huge \bf༆ Answer ༄[/tex]

Use PEDMAS/BODMAS rule for simplification !

Let's solve ~

[tex] \sf{48} \div 6 + (5 \times 6) \times 13 + 6[/tex]

[tex] \sf48 \div 6 + 30 \times 13 + 6[/tex]

[tex] \sf8 + 30 \times 13 + 6[/tex]

[tex] \sf8 + 390 + 6[/tex]

[tex] \sf404[/tex]

Write an exponential function to model each situation. Find each amount after the

specified time.


A population of 1,236,000 grows 1.3% per year for 10 years

Answers

The formula would be y = 1,236,000(1.3)^t

After 10 years, the population would grow to become 17,039,309.59 people. You can round up to 17,039,310 people if the question asks to round to the nearest person.

Guided Practice
Give a reason to justify the equation.
3y+ (-5y) = [3+ (-5)]y
A. Commutative Property of Addition
B. Associative Property of Addition
C. Distributive Property

Answers

B. Associative Property of Addition


I need help completing this question.

Answers

Answer:

9.73556* 10^34

Step-by-step explanation:

A day and a half is 36 hours  ( 1 day is 24 hours)

1.5 days is 24 * 1.5 = 36 hours

P(t) = 300  ( 2) ^ 3t

t = 36

p(36) = 300 * 2^ (3*36)

         = 300  * 2^108

         =9.73556* 10^34

Using a compass and a straightedge, a student constructed a triangle in which XY is one of the sides.

Answers

The length of the compass so that ΔXYZ is isosceles and not equilateral could be;

Option C; between ¹/₂XY and XY

Option E; greater than XY

We are told that;

Student has drawn a line XY

Now the student opened the compass with a set length to draw two intersecting arcs with X and Y as centers.

Now, for these two arcs to meet, the compass has to be opened to a length that is more than half of segment XY.

Secondly, since the triangle is not equilateral, it means the compass cannot be opened to length AB.

The next step would be t open the compass to a length slightly bigger or slightly smaller than AB.

Finally, the options that apply are Options C and E.

Read more about construction of Isosceles triangles at; https://brainly.com/question/2520169

PLEASE HELPPPP

4(x−2 1/4)=−3.7

Answers


First let’s convert the mixed numbers to improper fractions 2 1/4 =9/4
Then u get 4(X-9/4) =-3.7
Now your gonna divide both sides by four
4(X-9/4) over 4 = -3.7 over 4
4/4 =1 …X=-9/4
-3.7/4 = -0.925
Now you’re going to add 9/4 to each side
X-9/4+9/4=-0.925 +9/4
-9/4 + 9/4 =0 (X)
Now you have just -0.925 and nine fourths
I converted 9/4 —> 2.25
Then u still have -0.925
So add 2.25+-0.925 u get ur X which is 1.325 (this is ur answer)

The volume of the triangular prism is 54 cubic units.
What is the value of x?
03
O 5
O 7
9
3x
what is the answer

Answers

Answer:

3 units

Step-by-step explanation:

I hope it helps you!

Use the diagonals to determine whether a parallelogram with vertices A(2, 7), B(7, 9), C(5, 4), and D(0, 2) is a rectangle, rhombus, or square. Give all the names that apply.

Answers

Step-by-step explanation:

A and B have among each other the same distance relation as D and C : +5 in x, and +2 in y direction

and D and A have among each other the same distance relation as C and B : +2 in x, and +5 in y direction.

that means the slope of the first pair of sides is 2/5, and the slope of the second pair of sides is 5/2.

and that means that these 2 pairs of lines are not perpendicular (for this not only would we need to have the ratio upside down but also the sign would need to be flipped). there are no 90° angles.

so, there is no rectangle or square.

but because the sums of x and y coordinate differences are the same, we have the same distances between neighboring points.

and that makes it a rhombus.

cos^2(90)+cos^2(120)+cos^2(135)+cos^2(150)+cos^2(180)​

Answers

Answer:

97

Step-by-step explanation:

Which is the graph of the ordered pairs from the table below?

X Y
3 5
5 7
7 9
9 11

Answers

Answer:

It is the second

Step-by-step explanation:

Answer: number 2    ᕙ(@°▽°@)ᕗ

Step-by-step explanation:

The equation 5y = 6 represents purchasing tubs of yogurt for $6. Which of these equations are equivalent to the equation 5y=6?
a 5y + 4 = 10
b 5y - 1 = 3
c 15y = 18
d 5y = 12

Answers

Answer:

blah blah

Step-by-step explanation:

Answer:

D

Step-by-step explanation:

1
A line has a slope of -2 and a y-intercept of -2.

What is the x-intercept of the line?
A -4
B -1
C 1
D 4

Answers

Answer:

B

Step-by-step explanation:

The equation of a line in slope- intercept form is

y = mx + c ( m is the slope and c the y- intercept )

Here m = - 2 and c = - 2 , then

y = - 2x - 2 ← is the equation of the line

To find the x- intercept let y = 0 in the equation and solve for x , that is

- 2x - 2 = 0 ( add 2 to both sides )

- 2x = 2 ( divide both sides by - 2 )

x = - 1

The x- intercept is - 1 → B

k + a/6 = 3k help b4 i cry my eyes out :’/

Answers

Answer:

Hope I explain it well!

Step-by-step explanation:

k + a/6 = 3k

well, I am not sure if we need to find the a, or the k, so lets find both!

--

First the a:

k + a/6 = 3k (subtract k)

a/6 = 2k (Multiply by 6)

a = 12k

--

Last, the k:

k + a/6 = 3k (Subtract k)

a/6 = 2k (Divide by 2)

a/12 = k

--

There you go, I hope you figure it out <3

1. 6(12+4)
2. 10+4(2+20)
3. 7(4+19)

Answers

Answer:

1. 6 x 16 = 96

2. 10 + 4 x 22 = 10 + 88 = 98

3. 7 x 23 = 161

Step-by-step explanation:

Which point would be a solution to the system of linear inequalities shown below?

Y>2/3x-4

Y<−4x−6

Answers

2/3x-4 im not all the way sure

ben's grandma gave him $75 in a new piggy bank. Ben will add $15 to his piggy bank each month. find x, the number of months Ben must add $15 until he has more than $225 in his piggy bank.

Answers

10 Months is the answer or it’ll be X=10

Help stuck on this question

Answers

place a point on -5, on the y axis. then draw a line straight through up one box and over one box placing points along the way to form a line

Math problem (easy)
……………………………………..

Answers

PEMDAS multiply first
(-3/8 x 1/2)
= -3/16
3/4 - 3/16 multiply numerator and denominator to simplify

12/16 - 3/16

9/16

Hope this helps!
Brainliest and a like is much appreciated!
The answer would be 9/16 :))))))

2. Graph each inequality on a number line:

5x + 15 < 0

Answers

Answer:

x < -3

Step-by-step explanation:

1. To put this inequality on a number line, we first must solve it.

Step 1: Subtract 15 from both sides.

[tex]5x + 15 - 15 < 0 - 15[/tex] [tex]5x < -15[/tex]  

Step 2: Divide both sides by 5.

[tex]\frac{5x}{5} <\frac{-15}{5}[/tex] [tex]x < -3[/tex]

2. Now that we know x < -3, let's graph it!

Since it's less than, we make the number line point to the left, and we make the circle open.

is y=3/4x proportional or non proportional

Answers

Yes, it’s proportional. it’s proportional because when you graph the equation it’s a straight line the goes through the origin! brainliest is always appreciated :)

factor the expression 14x - 21 using the GCF

Answers

you have to factor out the 7 because it goes into both 14 and 21. then you put the quotients from dividing into parentheses.

The volume of a cylinder is 600 pi cm cubed. The diameter of a base of the cylinder is 10 cm. What is the height of the cylinder?

Answers

Answer:

V = B * H      area of base * height

B = pi * (D / 2)^2 = pi * 5^2 = 78.5 cm^2

H = V / B = 600  cm^3 / 78.5 cm^2 = 7.64 cm

what is 3/7-7/14 as a fraction

Answers

-1/14
hope this is helpful!

Answer:

-1/14or-0.07

Step-by-step explanation:

3/7-1/2=(2x3)/(2x7)-(7x1)/(7x2)=6/14-7/14=(6-7)/14=-1/14or0.07

What is the value of the expression below when z=
5?

5z - 4

Answers

Answer:

Well we’ll just substitute

So 5z-4

And z is 5

5*5-4

25-4=21

The value is 21

The value is 21 I hope it’s right
Other Questions
5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade. 108 is what percent of 72 The boys and the Darling children.... A rectangle with a width of 4.6 inches has an area of 23 inches squared. What is the length? The Later Middle Ages7Which of the following was the site of the only victory achieved by the Crusaders in the Second Crusade?OA. ConstantinopleOB. LisbonOC. EphesusODDamascus Johnny has a box filled with 10 black marbles and 5 purple marbles.What are the odd he pulls two purple marbles in a row without replacemnet 3. Solve the formula A = 1/2 (b1+ b2))h for h. Show your work.