3
A
C
9
12
15
What do the dotted lines, indicated with the arrow, represent in the DNA model above? (B.6A)

3AC91215What Do The Dotted Lines, Indicated With The Arrow, Represent In The DNA Model Above? (B.6A)

Answers

Answer 1

Answer:

[tex]\fbox\red{question\:given}[/tex]

[tex]\blue{what \:is\: photosynthesis}[/tex]

[tex]\huge\fbox\red{Answer↓}[/tex]

[tex]the \: process \: by \: which \: green \: plants \: \\ turn \: carbon \: dioxide \: and \: water\\ \: into \: food \:using \: energy \: \\from \: sunlight.[/tex]

Answer 2
Hydrogen bonds between guanine and cytosine

Related Questions

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

Your skeleton enables you to move.


True
False

Answers

Answer:

True

Explanation:

Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Answer:

Allows movement: Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Explanation:

please mark my answer in brainlist

How is it possible to find the
number of heterozygotes in a
sample population, given the
allele frequencies?

Answers

Explanation:

The frequency of heterozygous individuals. Answer: The frequency of heterozygous individuals is equal to 2pq. In this case, 2pq equals 0.32, which means that the frequency of individuals heterozygous for this gene is equal to 32% (i.e. 2 (0.8)(0.2) = 0.32

To find the number of heterozygotes in a sample population, we need to know the allele frequencies and the total number of individuals in the population. The formula used to calculate the expected number of heterozygotes in a population is based on the Hardy-Weinberg equilibrium principle.

The Hardy-Weinberg equation is given as:

p² + 2pq + q² = 1

Where:

p = frequency of one (dominant) allele

q = frequency of the other allele (recessive) allele

p² = expected frequency of homozygous dominant individuals

2pq = expected frequency of heterozygous individuals

q² = expected frequency of homozygous recessive individuals

To find the number of heterozygotes, we can multiply the expected frequency of heterozygotes (2pq) by the total population size. This will give us an estimate of the number of individuals in the population who are heterozygous for the specific gene of interest.

Learn more about Hardy-Weinberg equation in:

https://brainly.com/question/29776155

#SPJ2

What is the function of the structure labeled C in the diagram to the right? it is where water, dissolved substances, and urea are filtered out of the blood.

Answers

Answer:

B. It captures the substances filtered out of the blood.

Explanation:

Edge 2021

Answer: B

It captures the substances filtered out of the blood.

Explanation:edge 2022

Deana applies the data in the table to calculate the rate of population increase or decrease of each country. Which assumption is necessary for Deana’s calculations to be accurate?

Answers

It should be noted that population is simply used for the determination of the economic activity of an area or country.

Your information is incomplete. Therefore, an overview of population will be given. Population simply means the inhabitants of a particular place or the number of organisms living in an area.

The increase or decrease in the rate of population is calculated by the formula:

= (New population - Old population) / Old population × 100

Learn more about population on:

https://brainly.com/question/13403673

According to Hebrews 11, what did Abraham believe God would do if Isaac was slain as a sacrifice?

Answers

Answer: Isaac

Explanation:

How does the carbon stored in the bodies of living organisms move into rocks?(1 point)

Carbon dioxide released through respiration dissolves in certain rocks, like limestone.

Living organisms decay, releasing carbon into the soil, and soil is compacted into rocks.

Living organisms decay and become fossils fuels, which eventually become rocks.

Carbon dioxide dissolves in ocean water and is slowly absorbed by rocks in the ocean.

Answers

In the atmosphere, carbon is stored in the form of gases, such as carbon dioxide. ... This carbon can then be ingested and stored in animals that eat the plants. When the animals die, they decompose, and their remains become sediment, trapping the stored carbon in layers that eventually turn into rock or minerals.

When animals die, their bodies degrade into the soil, encasing the carbon in layers that eventually transform into rock or minerals. hence option b is correct.

What is rock?

Stone including limestone and its minerals is created when sediment and shell layers are bonded together over time.

Gases like carbon dioxide are among the forms of carbon that are stored in the atmosphere. Animals that consume the plants can then absorb and store this carbon.

When animals die, their bodies degrade into silt, encasing the carbon in layers that eventually transform into rock or minerals. Some of this silt may eventually turn into fossil fuels like coal, oil, or natural gas, which when burned, release carbon back into the atmosphere.

Therefore, when an animal dies to decompose into the soil which becomes rocks through carbon from living organisms moves into rocks, hence option b is correct.

Learn more about rocks, here:

https://brainly.com/question/23464190

#SPJ2

pls check help /edtrphzjbi​

Answers

Answer:

I don't get it but heres your answer

Explanation:

sharghvquvbOIQUugua

There you go!

Write any two adaptational characteristics of camel on the basis of habitat.​

Answers

Long eyelashes that doesnt allow the sand to get into its eyes
And its ability to store water for long periods of time in its hump

My dad scolded me i don’t wanna live with him I hate him

Answers

dam well i been thru worse L rip
I’m sorry to hear that, does he do that often? You should check in with a trusted adult and tell them about this. I hope you stay safe, healthy, and take care!

ASAP
Give an example of psuedo-science and explain why it is not considered true science.

Answers

Answer:

Astrology

Explanation:

Astrology is considered a psuedo-science because there are not rock hard scientific facts. While it may have a lot of other evidence behind it, it is not a 'scientific' science.

Proteins are synthesized based on genetic information carried by DNA. Explain In you’re own words how the structure of DNA is important in the
synthasis of different kinds of proteins, In your explanation, include a description of the two main processes involved in
protein synthesis.

Answers

Answer:

Explanation:The synthesis of proteins occurs in two sequential steps: Transcription and Translation. Transcription occurs in the cell nucleus and uses the base sequence of DNA to produce mRNA. The mRNA carries the message for making a specific protein out to the cytoplasm where translation occurs.

Ba
Regarding cell walls, which of
these is the MOST accurate?
im
A. Cell walls and cell membranes are the very
same thing
B. Cell walls burst any time the cell takes in too
much water.
C. Cell walls keep a plant, bacteria or fungus cell
from bursting when too much water is absorbed

Answers

Answer:

C

Explanation:

cell wall

When water moves into a plant cell, the vacuole gets bigger, pushing the cell membrane against the cell wall. The force of this increases the turgor pressure within the cell making it firm or turgid . The pressure created by the cell wall stops too much water entering and prevents cell lysis.

Pandas eat bamboo for energy. What are pandas classified as

Answers

Answer:

A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.

Explanation:

A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.

Answer: consumers

Explanation: I took the test on edg

This part of a plant cell makes the process of photosynthesis possible.
Chloroplast
O Mitochondria
O Centrioles

Answers

The chloroplast is the organelle of a plant cell that makes the process of photosynthesis possible.

Photosynthesis refers to the metabolic reactions by which plant cells synthesize simple carbohydrates (glucose) by using the light energy from the sun and carbon dioxide.

Photosynthetic reactions can be divided into light-dependent reactions and light-independent reactions.

During photosynthesis, light-dependent reactions occur in the thylakoid membranes of chloroplasts.

In conclusion, the chloroplast is the organelle of a plant cell that makes the process of photosynthesis possible.

Learn more about chloroplasts here:

https://brainly.com/question/2512051

Plant and animal cells are both eukaryotic. This means they...
O Have a nucleus
O Contain DNA and RNA.
O Can reproduce on their own.

Answers

the answer is the first one they both have a nucleus!

A white woman says she is not racist but avoids sitting near Black individuals. She has

A.high explicit racism, low implicit racism
B.high explicit racism, high implicit racism
C.low explicit racism, low implicit racism
D.low explicit racism, high implicit racis

Answers

I believe it is A
Please make this the brainliest answer

PLEASE HELP WITH THIS ONE QUESTION

Answers

Answer:

Fourth option

Explanation:

ATP - Adenosine Triphosphate (3Ps), ADP - Adenosine Diphosphate (2Ps). ATP breaks down into ADP because it loses a Phosphate Anion in whatever process that the ATP is becoming ADP.

In the image provided, fourth image shows how ATP breaks down into ADP. Option D is the correct answer.

ATP (adenosine triphosphate) is a molecule that stores and provides energy for cellular processes. When ATP is used, it undergoes a process called hydrolysis, where a water molecule is used to break a high-energy phosphate bond in ATP. Option D is the correct answer.

During this hydrolysis process, one of the phosphate groups in ATP is cleaved off, resulting in the formation of ADP (adenosine diphosphate) and an inorganic phosphate (Pi). The energy stored in the phosphate bond is released, making it available for cellular functions. The breakdown of ATP into ADP allows the released energy to be utilized by cells for various activities, such as muscle contraction, active transport, and synthesis of molecules.

Learn more about Adenosine Triphosphate here:

https://brainly.com/question/897553

#SPJ2

28 The statements describe four different plants.
Which plant must be a monocotyledon?
A The flowers are wind-pollinated.
B The flowers each have five petals.
The leaves are large with a clear network of veins on them.
The leaves have parallel veins.

Answers

Answer:

The leaves have parallel veins

​​​​The desertification of an area from deforestation due to mining gold would be a(n) ___ cost of the gold.
indirect
direct

Answers

Answer: the answer would be indirect

Here is fs fs da last graph I need help so someone plz help me

Answers

I would need to see more of the picture to give you an answer. Try quizlet!

In which of the following ways can albert reduce the resources he consumes

Answers

Answer:

where is option man?

please,send option also

Need help right now can’t figure it out

Answers

Answer:

[tex]\huge\boxed{Alkane.}[/tex]

Explanation:

The given compound is an alkane because all the bonds between carbon are single. Alkanes have all single bonds and are thus called saturated hydrocarbons.

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

Which scenario describes an interaction between two of Earth’s spheres?

Water flows from a stream to a lake.
Gravity moves rocks to another location.
Lions use energy to catch other animals for food.
Bears dig big holes in the ground to protect their young.

Answers

#2: Gravity moves rocks to another location

Answer:

The scenario that describes an interaction between two of Earth's spheres is "bears dig big holes in the ground to protect their young".

Explanation:

The Earth spheres include the biosphere, the hydrosphere, the geosphere, and the atmosphere. In this context, there is an interaction between two spheres: the biosphere and the geosphere, when a bear digs holes in the ground because a living organism that is part of the biosphere is modifying the structure and shape of superficial soil, which is part of the geosphere.

Match the materials below to the BEST option describing their place in the cycles of photosynthesis and cellular respiration.



Some options may be used more than once or not at all.

Answers

1b, 2b, 3a, 4c, 5d, 6g, 7e, 8h

I hate my biology teacher but he’s such a D.a.d.d.y

Answers

Answer: Dam

Explanation: Dammmmmmmmm

Granite is an intrusive igneous rock with large crystals because it cools slowly. Where was this rock most likely formed ?

A - in a river
B - deep inside a volcano
C- in a mountain range
D- on the surface of a volcano

Ik the answer is not c
Can someone help me figure this out plz and thank you

Answers

Answer: D

Explanation: Because rock cools on the surface of the volcano and I know because I learned about volcanoes and I went through the topic.

Granite is an intrusive igneous rock with large crystals because it cools slowly. this rock most likely formed on the surface of a volcano. thus option D is correct.

What is rock cycle ?

Rocks are naturally occurred on non-living earth which are made by collection of  mineral grains held together in a firm, it can be tiny or big as well and can be easily identified with their texture.

The Rock cycle can be defined as a continuous process through which old rocks are transformed into new rock due to cool down of molten magma, when it solidifies become igneous rock.

In a rock cycle, when the break down of these igneous rocks occur  small particles that are transported and deposited to form sedimentary rocks,  When the igneous and sedimentary rocks heated up and under the pressure they change into metamorphic rocks.

The metamorphic rocks which are subjected under great heat and pressure melt down to form molten magma which again can cool down and solidify into igneous rocks

For more details regarding rock, visit

brainly.com/question/9243222

#SPJ2

How can i earn money from this app?

Answers

Answer:

u dont earn money from brainly. the point is altruistic help

Explanation:

if u mean something else, provide context and ill leave a comment with the correct answer

Individuals that are better suited to their environment are likely to have more offspring and pass their genetic material onto future generations. This theory is referred to as ____.

Question 1 options:

Use and Disuse


Endosymbiosis


Evolution


Natural Selection

Answers

Answer:

Natural selection

Answer:natural selection

Explanation:

[answers included, 100% on assignment]
1. Compared to today’s corn plant, teosinte:
✔ (c) is shorter and has more branches.

2. About how many genes were involved in producing the dramatic differences between teosinte and modern corn?
✔ (b) 5

3. he gene for which of the following traits changed early in teosinte domestication and caused dramatic changes?
✔ (a) kernel covering

Answers

I think is that but correct me if I’m wrong

Answer:

C

B

A

Explanation:

Other Questions
How did NASA help to distinguish genetic factors from environmental ones when studying the effects of living space?. What is the molarity of a solutionmade by dissolving 67.3 g of lithiumchloride (LiCl) in enough water tomake 2.37 L of solution?Molar Mass Li: 6.94 g/molMolar Mass Cl: 35.45 g/mol What do murals do for a community?How do they affect the urban landscape i got a important question for yallfor the last week now ive been having sudden pains in my stomach, it hurts really bady and im trying to avoid going to the doctors cause i don't trust them at all. I just need to know if anyone knows any other way i can get rid of these sudden sharp pains in my stomach The area of each square tile is square feet and the area of each triangular tile is square foot.We will pour sand into each frame to a depth of foot.image placeholder ftComplete the sentence with the amount of sand we will need for each tile.We will need ft of sand for each square tile, and ft of sand for each triangular tile. 1. Represent the following sentence as an algebraic expression, where "a number" is the letter x. 8 is added to a number.2. When solving an equation, Bianca's first step is shown below. Which property justifies Bianca's first step?Original Equation:4x-5= -4First Step:4x= 1A. multiplication property of equalityB. addition property of equalityC. commutative property of additionD. commutative property of multiplication HELPPPP ME WITH THIS ONEEEE What will $82,000 grow to be in 11 years if it is invested today at 8% and the interest rate is compounded monthly How often do domain controllers download Group Policy settings? Describe the function of the denticulate ligaments? the amount in Jamaican dollars one would get for US $200 The equation \sqrt{6-y^2}=x 6y 2 =x is a function of yy." a standard dipstick urinalysis includes ____________. I need help please :( Which best describes the Supreme Court decision in the dred Scott case? Please answer when u can! (asap, pls in 5 or less minutes ;-;) No links pls((THE QUESTION INFO) Marina, Cleo, and Paul are buying paper plates for a big cookout. A 4-pack of plates sells for $0.37 and a 48-pack sells for $3.84. They each use a different method to decide which option is the best buy. Decide which methods use correct reasoning. Write an equation relating the cost C to the number of plates p for the best option. )question B. Write the equation for the best option, relating the cost C to the number of plates p. Am I right? Should I've to add more info?(only about Rectangle and Square) Which president said, when declaring war on Germany, that we were going to "make the world safe for democracy"? aTheodore Roosevelt bFranklin Roosevelt cDwight Eisenhower dWoodrow Wilson M is directly proportional to r when r=4, m=160.work out the value of r when m=20 plsss help meee: Which two types of stanzas are used in a Petrarchan sonnet?