According to Newton's first law, which characteristic of a moving object would remain constant if there were no othe
forces acting on it?
O size
mass
shape
speed

Answers

Answer 1

Answer:

The mass

Explanation:

The mass is can somewhat control the speed of an object like the rollback can.

Answer 2
The answer is speed
Hope this helps:)

Related Questions

what is the answer? for this

Answers

Answer:

b

Explanation:

because it is the least inclined

What is the answer for this question science pls smart people

Answers

Answer:

B, all the other answers are just details that would be in an article, but not the main idea.

Explanation:

Answer:

B.

Explanation:

the other answers are not main ideas

What are the important plants in agriscience?

Answers

Answer:  Major grain crops are corn, wheat, barley, oats, rye, rice, sorghum, and soybeans. Less than 10 percent of the corn grown in the U.S. is for human consumption. Legume plants such as dry beans and peas are important foods in the diet of many Americans and people around the world.

Explanation:

A kitten embryo is growing inside the uterus of a cat. What is happening to the cells of the kitten embryo?

A) Mitosis, the cells are differentiating

B) Meiosis, the cells are differentiating

C) Meiosis, the genes are being shuffled around

D) Mitosis, genes are being shuffled around

Please answer and don't put fake answer I really need this right.

Answers

The answer to this is A. mitosis, the cells are differentiating

Your skin is an example of a nonspecific defense mechanism. Why is it called a nonspecific defense mechanism?

A. becuase it protects against any invader regardless of type
B. because it has to be 'alerted' that a foreign invader has been spotted
C. because it alerts the immune system when a foreign invader is spotted
D. because it protects against a specific type of pathogen

Answers

Answer:

A is the answer

Explanation:

This is what skin does, it blocks outside material from getting into the body regardless of what it is.

GUYS PLEASE PLEASE HELP WITH THIS!!!

Answers

Answer:

energy carried by waves: sound and radiant energy

Answer:

energy carried by waves-sound and radiant energy

Explanation:

Hindus refer to the three most important parts of Brahman as:
A. Vishnu.
B. Shiva.
C. Ganesha.
D. Trimurti.

Answers

Answer:

D. Trimurti

Explanation:

thanks hope it helps

A scientist isolates a disease-causing particle. Which of the following properties would indicate that the particle is a virus and not a bacterium?

Answers

Answer:

The property that could indicate that the particle is a virus is an absence of cellular machinery (option B). Explanation: Viruses are particles that are not considered to be living organisms, which is due to a complete absence of organelles or cellular functions.

Explanation:

Which of the following is a way that nitrogen atoms move from a nonliving part of the environment into a living part of the environment?

Answers

Answer:

person below is correct

Explanation:

Answer:

Nitrogen Cycle

Explanation:

nitrogen moves through the living and non-living environments with the help of decomposers and nitrogen-fixing bacteria

which organisms transform nitrogen to a form that useful to plants

Answers

Answer:

nitrogen-fixing bacteria

Answer: A

Explanation:

A substance whose shape can easily change is a
a.
solid.
b.
powder.
c.
fluid.
d.
metal.


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

fluid.

Explanation:

because there molecules can freely move and take the shape of any container

PLZZZZZ HELP WILL GIVE BRAINLIEST
NO LINKS!!
OR ELSE

A person is taken to the emergency room at Baptist Hospital vomiting, bleeding and with severe diarrhea. He complained of a headache, shortness of breath and body aches. The doctor quickly checked the composition of the patient’s blood plasma, the light-yellow liquid that carries salts and enzymes, and determined he was severely dehydrated. Thus, causing a severe loss of fluid in the blood and an increase of blood cell concentration. The doctor prescribed intravenous liquids (IV) and rest.

Based on the patient’s symptoms and doctor’s initial prognosis, how does dehydration affect a person’s blood flow and blood pressure? SC.912. L.14.36

The patient’s blood viscosity would increase, causing blood flow to increase and blood pressure to decrease

The patient’s blood viscosity would decrease, causing the blood flow and blood pressure to remain at a stable rhythm

The patient’s blood viscosity would decrease, causing the blood flow to decrease and the blood pressure to also decrease

The patient’s blood viscosity would increase, causing the blood flow to decrease and the blood pressure to increase

Answers

Answer:

The answer is "The patients blood viscosity would decrease, causing the blood flow to decrease in the blood pressure to also decrease".

The correct answer is: The patient’s blood viscosity would increase, causing the blood flow to decrease and the blood pressure to increase.

What is Dehydration?

When the body loses more fluid than it takes in, dehydration develops. It occurs when the quantity of water and electrolytes (such as sodium, potassium, and chloride) that the body need to operate correctly are out of balance.

Numerous internal processes, such as controlling body temperature, lubricating joints, transferring nutrients, and getting rid of waste, depend on water.

Dehydration causes the amount of fluid in the blood to decrease, which causes the concentration of blood cells and other components to rise.

Blood gets thicker and flows more slowly as a result of this rise in blood viscosity, which is caused by an increase in blood cell concentration.

As a result, the blood flow decreases, and the resistance to blood flow increases, leading to an increase in blood pressure.

Therefore, in the given scenario, the patient's severe dehydration would cause an increase in blood viscosity, leading to a decrease in blood flow and an increase in blood pressure.

Learn more about dehydration at:

https://brainly.com/question/12261974

#SPJ2

Which of the following biotic factors is associated with increasing the capacity of the organisms to move across fragmented landscapes? Patch size, connectivity,Patch shape, Distance from other landscape patches

Answers

Answer:

connectivity

Explanation:

Natural and anthropogenic alterations affect the landscape. The unmeasurable use of the land for farming, cattle industry, buildings, among many other activities, has caused a severe fragmentation in the original landscape that has been seriously affecting biodiversity.    

Fragmentation occurs when a big extension is transformed into many different and smaller patches, separated by another type of cover. You can imagine, for instance, an area used for mono-culturing, which you can see as a homogeneous space of the same texture and color, and small green islands of original vegetation dispersed in this cropped area. These small islands are separated from each other by the crop.

These alterations produce patches or tesserae in the landscape. Patches are relatively homogenous areas with well-defined borders and environmental characteristics very different from those of the surrounding areas. These are like islands. You can think about patches or tesserae as the remaining pieces or units of the original landscape dispersed inside an affected bigger-sized area.

Fragmentation generates a significant loss of physical continuity between the different areas of the original habitat. It might negatively affect biodiversity by decreasing patch sizes, completely isolating them from each other, and increasing the border effect.

Many species can not survive if they are not in the original habitat. Probably they do not find enough food or shelter, or they are very exposed to predation. So they need to stay in the patch. Most of these species are not even adapted to living on the border of the patches. Eventually, fragmented areas can not support some population species that end by dying because they can not survive for a long time in that reduced place. Patches are not suitable to support too many species.

For these reasons, the connection between islands becomes so important.  To allow species to move from one place to the other, interact with other species, reproduce, find food, shelter, avoid predation. In other words, survive.  Connectivity is how the territory makes possible individuals flow or genetic flow, between the different tesserae.

The blue is my guess

Answers

I agree with your guess

6. Which is the youngest holiday: "Earth Day" or "Arbor Day"?
HELP!!!! QUICK PLEASE ILL GIVE BRAINLIEST

Answers

Arbor Day is younger

What does Hemoglobin pick up once it has given up all its oxygen molecules?
A. Carbon dioxide
B. Nitrogen
C. Carbon

Answers

Answer:

Carbon dioxide

Explanation:

Hb has been observed in the epithelial cells of human tissues including lungs neurons retina and. endometrium our group has recently demonstrated tha Hd is expressed by the cervicovaginal epithelial cells.

what is a vector in life science​

Answers

Answer: They are used in science to describe anything that has both a direction and a magnitude. They are usually drawn as arrows, the length of which represents the vector's magnitude.

CREDIT: scientificamerica

The production of red blood cells is regulated by a feedback loop involving erythropoietin. In non-disease states, the production of red blood cells is equal to the destruction of red blood cells, thus maintaining sufficient red blood cells to deliver adequate oxygen to the body's tissues. However, when the number of red blood cells decrease and oxygen levels are low, erythropoietin is produced by the liver and kidneys to increase the production of red blood cells. Is this a positive or negative feedback loop

Answers

Answer:

Negative feedback.

Explanation:

The production of erythropoietin by the liver and kidneys is a negative feedback because with the production of erythropoietin, our body tends to move to become more stable state. The erythropoietin is produced by the liver and kidneys to increase the production of red blood cells if the quantity of red blood cells are lower than the normal range. If the number of red blood cells are decreases the oxygen level in our body is low that leads to unstable condition of the body but when the concentration of red blood cells increases, the body move towards stability.

What are tissues made of?
A. Groups of organs
B. Groups of reflexes
C. Groups of cells
D. Groups of systems

Answers

Answer:

C

Explanation:

A tissue is made up of lots of the same type of cells

Answer:

C. Groups of cells

Explanation:

They are made up of cells. When they are formed together, they carry out specific functions.


PLZZZZ HELP WILL GIVE BRAINLIEST
Based on the patient's symptoms and doctor's initial prognosis, how does dehydration affect a person's blood flow and blood pressure?
The patient's blood viscosity would increase, causing blood flow to increase and blood pressure to decrease

The patient's blood viscosity would decrease, causing the blood flow and blood pressure to remain at a stable rhythm

The patient's blood viscosity would decrease, causing the blood flow to decrease and the blood pressure to also decrease

The patient's blood viscosity would increase, causing the blood flow to decrease and the blood pressure to increase

Answers

Answer:

Maintaining a normal blood volume is necessary for blood to be able to adequately reach all of the tissues of your body. When you're very dehydrated, your blood volume can decrease, leading to a drop in blood pressure. When blood pressure drops too low, your organs won't receive the oxygen and nutrients they need. might be what you are looking for but if not i will change it

Explanation:

all of the following gases are naturally occurring in the atmosphere EXCEPT—

a) CO2
b) H2O
c) NO2
d) CFCs

Answers

Answer:

CFCs

Explanation:

because CO2,H20,NO2 are all naturally occurring and CFCs are man made

Need help with this one

Answers

Answer:

i think its a but i am not absoulty sure

Explanation:

Answer:

Answer A

Explanation:

I did the quiz as well lol

Several examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. To inhibit the transcription of a bacterial gene with antisense RNA, what sequence might the antisense RNA contain

Answers

Answer:

An antisense sequence with complementary to the target mRNA encoded by the gene of interest

Explanation:

An antisense sequence is usually a short RNA sequence specifically designed in the laboratory to bind by complementary to the DNA/RNA sequence of interest (usually a target mRNA) whose expression is desired to be inhibited. When an antisense bind to its target mRNA, the antisense sequence acts to block translation, thereby inhibiting protein synthesis. Moreover, it has been shown that the double-stranded antisense-RNA complexes may also increase the susceptibility of the target sequence to RNase H digestion.

what type of joints make up the skull?

Answers

Answer:

The bones of the skull are highly irregular. Most of the bones of the skull are held together by firm, immovable fibrous joints called sutures or synarthroses. These joints allow the developing skull to grow both pre- and postnatally.

Explanation:

Answer:

какву врсту питања

kakvu vrstu pitanja

Explanation:

Hypothesize a reason as to why vaccinations were successful in immunizing an individual for the smallpox virus?

Answers

Answer:

vaccine make people immune to small pox

What are the gametes that would be formed for the following genotype: Aa?

Answers

Answer:

An individual with the genotype Aa can make two types of gametes: A and a. Since this is a random process, the individual will, on average, make equal numbers of each gamete. (Frequency of 1/2 for each gamete). A second individual with genotype Aa can make two types of gametes: A and a.

original source of energy for killer whale​

Answers

Answer:

food would probably be the best answer

A pyramid of biomass shows the mass of all of the organisms in each trophic level of an ecosystem. Look at the biomass pyramid to the right. Based on the data shown, how many kilograms of plant matter would be needed to support the other trophic levels in this ecosystem?

Answers

Answer:

90,000

Explanation:

A pyramid of biomass shows the mass of all of the organisms in each trophic level of an ecosystem. From the biomass pyramid to the upright ladder, the kilograms of plant matter needed to support the other tropic levels in this ecosystem is 9000 kg.

In ecology, the biomass pyramid is a graphical representation designed to show the quantity of biological or organic matter observed in an organism.

The ecological biomass pyramid starts with the primary producer which is usually a green plant.

Followed by the herbivores(animals that feed) on the green plants. They are the primary consumers. The carnivores are secondary consumers that feed on herbivores. Then the peak of the pyramid is the tertiary consumers which are called omnivores. (i.e animals that feed on plants & animals).

The amount of mass consumed by the primary consumer is equivalent to the total amount of mass in the primary consumer. However, as we go up the pyramid, the mass depreciates.

Therefore, we can conclude that the amount of kilograms of plant matter needed to support the other tropic levels in this ecosystem is 9000 kg.

Learn more about Biomass here:

https://brainly.com/question/20572728?referrer=searchResults

What direction will the white molecules tend to move?

Answers

The population of white molecules will move from left to right , as the concentration of white molecules is lesser on the right side than on the left.

How to explain the information

In the scenario you described, where the concentration of white molecules is higher on the left side and lower on the right side, the white molecules would indeed tend to diffuse from left to right. This is because molecules naturally move from regions of higher concentration to regions of lower concentration in an attempt to equalize the concentration throughout the system.

As the white molecules move from left to right, the concentration gradient across the system will gradually decrease until equilibrium is reached. Hence, movement of molecules will be from higher concentration to lower concentration.

Learn more about molecules on

https://brainly.com/question/475709

#SPJ1

Warm air holds _____.
less water than cool air
the same amount of water as cool air
more water than cool air

Answers

Answer:

less water than cool air

Explanation:

the warmer it is, the more the droplets(water) start to evaporate

hope this helps :)

Other Questions
historically, demand has averaged 408 units per week with a standard deviation of 160. the company currently has 48 units in stock. what is the probability of a stockout?a.225.0% b. 48.778% c.1.222% d..98.778% e.50.000% One of the tables below contains (X, Y) values that were generated by a linear function. Determine which table, and then write the equation of the linear function represented by the:Table #1:X 2 58111417 20Y1 3713213143Table #2:X 1234567Y 10 13 18 21 26 29 34Table #3:X2 4 6 8101214Y1 61116212631Equation of a Line in:A line in R is composed of a set of ordered pairs possessing the same degree of slope.To structure the equation of a line, we must have a point (a,b) and the slope. Which of the following is not an example of a capital investment? ...Which of the following is not an example of a capital investment? A.)The implementation of a new manufacturing technique.B.)The purchase of raw materials for inventory.C.) The installation of a computer based record keeping system. D.)The expansion of a business into new territories. E.)The purchase of new manufacturing equipment. Vera has an adjustable-rate mortgage, and her monthly payments are reset annually based on the prevailing market rate. She is wondering about the effect of an increase of 0.5 percent in the interest rate on her mortgage payment. Vera is O displaying traits of an agonizer. O conducting a sensitivity analysis. O estimating her opportunity cost. O conducting incremental analysis. discuss the link between agenda setting and the development of legislation. the function analogwrite(5, 100), will produce how much average voltage on pin 5? group of answer choices between 0 to 2 volt between 2 v to 5 v 5 v 100 v as this section has demonstrated, people in high-income countries generally have better health than those in low-income countries. think back to what you learned about theories of global inequality. Please help me Im timed Find the general solution of the nonhomogeneous differential equation, 2y""' + y" + 2y' + y = 2t2 + 3. Fill in each box below with an integer or a reduced fraction. (a) log 16: = 4 can be written in the form 24 = B where A = and B = (b) log, 125 = 3 can be written in the form 5C = D where C = and D= = Aman Private School is a new Integrated School just operating at Puncak Alam. Since the school is still new, the policy of the fee collection is only by cash payment. The process of fee payment for these 2 months is as follows: Miss Huda is an account clerk who will receive the cash fee payment made by the parents every day. She will issue the original receipt of payment to respective parents and cash collected is kept in the locked drawer near her place. The copy of the receipts then will be stored in the collection file. At the end of the school hours, she will count the cash and prepare the daily report that shows the fee details to ensure it is tally with the daily receipts issued. Normally, the total cash received every day is around RM 1,000 and above, and it can be 5 times higher at the beginning of the new month. Encik Zaki, the account assistant will make a cash deposit to the bank in the next following days. The bank in slips will be attached to the daily report after the deposits were made. The daily report will be used by Puan Aina to record in the MYOB Accounting System every week. She also prepares bank reconciliation every two months and authorized by Encik Mohd as Head of Account Department. Required: Assess any four (4) weaknesses in the internal control system in Aman Private School in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key The total population of the United States exceeds 328 million people. Many transactions each day are needed to feed, clothe, and shelter a population of this size. The number is huge. It all works because the US economic system distributes the output of farms and factories. This example shows that ___________. a. marketing is important to business b. marketing dominates supply chain activities c. distribution is the focus of marketing d. distribution is not part of marketing activities select all of the following that would be soluble in the dichloromethane layer of an extraction that utilizes water and dichloromethane as its liquid layers: group of answer choices cyclopentane sodium chloride ethoxypropane methylcyclohexane lithium acetate Which of the following is an example of foreign direct investment in China? A.Chinese Shenzen Airlines company buys a small U.S. midwest airline company, Air Chicago. B.A U.S. foreign exchange speculator buys $200,000 worth of the Chinese currency the yuan. C.U.S. auto entrepreneur Elon Musk buys stock in Alibaba Group Holding Limited of Hangzhou, China. D.The U.S. company Walmart buys a warehouse in Shanghai. E.The bank of China purchases U.S. Treasury bonds. Comment on the significance of each concept in terms of the role it plays in helping us to understand the nature of international economic relations.1. Internal economies of scale.2. A carbon tariff.3. The real exchange rate. Police infotainment tends to privilege which criminal justice frames? T/F. robust australopithecines had large chewing muscles but lacked a sagittal crest.