Add. Simplify the answer and write it as a mixed number.
1/4+4/5+9/10

Answers

Answer 1

Answer:

39/20 = 1.95

That's my simplified answer

39/20 = 1 19/20

Will this help?

Step-by-step explanation:

Answer 2

Answer:

[tex]1\frac{19}{20}[/tex]

Step-by-step explanation:


Related Questions

a number line is divided into 8 equal parts to show eighths. A point is labeled 1/2. Name the equivalent fraction for the labeled point.​

Answers

Answer:

4/8.

Step-by-step explanation:

4/8 is the correct answer for this question. This is why. If you take 8 and divide it in half, your answer will be 4. Also because fractions are division so the fraction 8/2 equals 4. This means the 1/2 mark is equal to 4.

Can someone give the answer to question 2

Answers

Step-by-step explanation:

try doing a2+b2=c2 it will help

select 2 points fir each of the following equations: y=2x+9 -6x=4+2y

Answers

the two points for each equation are:

For y = 2x + 9:

Point 1: (0, 9)

Point 2: (3, 15)

For -6x = 4 + 2y:

Point 1: (0, -2)

Point 2: (2, -8)

How to find the two points of the equations

To find two points for each of the given equations, we can arbitrarily choose values for x and then calculate the corresponding y values.

For the equation y = 2x + 9:

Let's choose x = 0:

y = 2(0) + 9

y = 9

So, one point is (0, 9).

Let's choose x = 3:

y = 2(3) + 9

y = 6 + 9

y = 15

Another point is (3, 15).

For the equation -6x = 4 + 2y:

Let's choose x = 0:

-6(0) = 4 + 2y

0 = 4 + 2y

-4 = 2y

y = -2

One point is (0, -2).

Let's choose x = 2:

-6(2) = 4 + 2y

-12 = 4 + 2y

-16 = 2y

y = -8

Another point is (2, -8).

Therefore, the two points for each equation are:

For y = 2x + 9:

Point 1: (0, 9)

Point 2: (3, 15)

For -6x = 4 + 2y:

Point 1: (0, -2)

Point 2: (2, -8)

Leearn more about equation at https://brainly.com/question/14107099

#SPJ1

I need help on my tips for math could someone be nice and help

Answers

Answer:

A im pretty sure its a try it and let me know

A box is being packed with cubes that measure 1 cubic foot. What is the volume of the box in cubic feet

Answers

Answer:

81 cubic foot

Step-by-step explanation:

It is given that the box is packed with cubes whose side is 1 foot. So the volume of one cube is 1 cubic foot.

Now from the figure, we can see that :

Number of cubes fitting the box across its length = 9 cubes

Number of cubes fitting the box across its width = 3 cubes

Number of cubes fitting the box across its height = 3 cubes

And each of these cubes measures 1 x 1 x 1 cubic foot

So the volume of the box can be found out by:

Volume = length x width x height

             = 9 x 3 x 3

             = 81 cubic foot

Therefore volume of the box is 81 cubic foot.

The list shows the number of pages in various novels: 286,295,307,241,396,368 what is the range

Answers

Answer:

155

Step-by-step explanation:

You must first subtract the lowest number (241) from the highest number (396) Then you get 155! I hope this helps!

Angle ACB and angle ECD are
angles.
vertical
complementary
supplementary
none of the above

Answers

Answer:

vertical

Step-by-step explanation:

When two lines intersect, 4 angles are formed. Two non-adjacent angles are called vertical angles.

Answer: vertical

Answer:

Vertical

Step-by-step explanation:

Just did the lesson and checked the answer key :D

You can complete one-sixth of a task in an hour. Your friend can complete one-sixth of the same task in an hour. How long will it take to complete the task if you work together? ​

Answers

Answer:

3 hours

Step-by-step explanation:

there's 6 parts and it takes them both an hour for each part so alone they would take 6 hours but divide that by 2 and it's 3 hours

Answer: I would say 3 hours if you worked seperatly from each other to complete one task

Step-by-step explanation:

In the figure above, if l ll m and r ll s, what is the value of x?
A) 65
B) 80
C) 85
D) 95
E) 115
Check the photo and please show the steps

Answers

Answer:

C x= 85°

Step-by-step explanation:

x+ 60° + 35° =180°

x= 180° - 60° - 35°

x= 85°

Explain what you would do first to simplify the expression below. Justify why, and then state the result of performing this step 27.27 4+2​

Answers

Answer:

33.27

Step-by-step explanation:

27.27 + (4 + 2)

You always perform the parenthesis first.

27.27 + 6

Then you add 6.

33.27

7 cameras cost $308. The cost of each camera is the same. What is the cost of each camera?

Answers

Answer:

$44

Step-by-step explanation:

Hello!

It said that 7 cameras cost $308, right?

If each camera costs the same, it means that 7 cameras with the same value equal $308.
If we use this in an equation, and if x is a variable we want to solve, it would be:

7x = 308.

If 7x = 308, it would be

308/7 =

44.

So, $44 is the answer.

Estimate 2.21x5.1 i guess need help please I don’t want to fell this class

Answers

Answer:

10

Step-by-step explanation:

Im guessing since you have to estimate it then u have to round them up. So if you move both of their points by 2 spaces (divide both by 100) They will be 221x510.

Round them up to 200x500.

That woule be 100 000. Then at the end just dont forget to divide by 10000.

Hope this was helpful

answer: 11.271 or 11.28

explanation:

what is the area of this quadrilateral? plz help

Answers

Answer:

D. 12 square feet

Step-by-step explanation:

Multiply 3 × 4 to get 12 and divide by 2 for the top triangle. Then, multiply 3 × 4 for the bottom triangle and get 12 and divide by 2. Add 6+6 to get 12

Solve each division problem, and classify it based on its quotient.

Answers

Answer:

show the image so i can answer

plz put the image  so i can see cus there are two types

Bananas cost $ 0.59 per pound.Write an equation that could be used to find the total cost,y,of x pounds of bananas.​

Answers

I think it is 5 Bc I do and if you got to know so bad

Answer:

Step-by-step explanation:

5

PLEASE HELP ME!!!! PLEASE HELP QUICK ILL GIVE U 73 POINTS PLS HELP

Answers

Answer:

3

Step-by-step explanation:

In this problem we need to kind of write the picture into an equation so the first thing we see are 4 xs on the far left-hand side this is representing "4x" then we see 5 - blocks on the right which represents "-5" because we have 5 minuses then on the other side we see 7 + blocks which represent just "7". After we identify everything in the picture we can write an equation so 4x -5 = 7. Then we solve so we need to separate x on one side and all the other numbers to the other to do that we can move the -5 to the side the 7 is on and because of math when we move a number to another side of the equation we have to switch the sign it has so if it was -5 then on the other side it would be 5 then we add 7 to 5 which would equal 12. Then we are left with 4x = 12 and to keep x on its own side we need to divide 4 from the other side because it is  multiplying on the x side and again we need to switch the sign. then we are left with x=3. Hope this helps!

The article " Inconsistent Health Perceptions for US Women and Men with Diabetes" presents results of a survey of adults with diabetes. The average body mass index (BMI) in a sample of 1559 men was 30.4, with a standard deviation of 0.6. The average BMI in a sample of 1924 women was 31.1 with a standard deviation of 0.2. Find a 99% confidence interval for the difference between the mean weights.

Answers

Answer:

The 99% confidence level (-0.741, -0.659).

Step-by-step explanation:

The average body mass index (BMI) in a sample of 1559 men was 30.4, with a standard deviation of 0.6.

The average BMI in a sample of 1924 women was 31.1 with a standard deviation of 0.2.

Find a 99% confidence interval for the difference between the mean weights..

The formula for 99% Confidence Interval for difference between the mean weights =

μ is the population mean, and σ is the population standard deviation.

μ1 - μ2 ± z × √σ²1/n1 + σ²2/n2

The z score for 99% confidence interval = 2.576

30.4 - 31.1 ± 2.576 × √0.6²/1559 + 0.2²/1924

-0.7 ± 2.576 × √0.36/1559 + 0.04/1924

-0.7 ± 2.576 × √0.0002309173 + 0.00002079

-0.7 ± 2.576 ×√0.0002517073

-0.7 ± 2.576 × 0.015865286

-0.7 ± 0.04086897674

Hence, the 99% Confidence Interval is

-0.7 - 0.04086897674

= -0.74086897674

≈ -0.741

-0.7 + 0.04086897674

=-0.65913102326

≈ -0.659

Therefore, the 99% confidence level (-0.741, -0.659).

Estelle swims for the Shorewood Sharks swim team, Last season, she kept track of how far
she swam at each practice.
Distance swam (m)
+
1,000
1,400
1,800
2,200
2,600
3,000
What was the shortest distance Estelle swam at practice?
meters

Answers

Answer:1,400

Step-by-step explanation:

The shortest distance Estelle swam at practice is 200 meters if the Estelle swims for the Shorewood Sharks swim team

What is the box and whisker plot?

A box and whisker plot is a method of abstracting a set of data that is approximated using an interval scale. It's also known as a box plot. These are primarily used to interpret data.

We have box plot data:

1,000    1,400    1,800    2,200    2,600    3,000

From the box plot:

The shortest distance Estelle swam at practice is given by:

= 1800—(1400+1800)/2

= 1800 – 1600

= 200 meter

Thus, the shortest distance Estelle swam at practice is 200 meters if the Estelle swims for the Shorewood Sharks swim team

Learn more about the box and whisker plot here:

brainly.com/question/3209282

#SPJ2


The human body is made up of about 9.3% hydrogen. What is the amount of hydrogen contained in a person who weighs 140 pounds? Round you answer to the hundredths place

Answers

Answer:

We know that for a human body 9.3% of its total mass is hydrogen.

Now we have a person with a mass of 140 lb.

Then we have that the 100% of the mass is 140lb, the 9.3% of this is hydrogen.

We can write:

9.3% = X

100% = 140lb

We want to find the value of X (mass of hydrogen)

Then we can take the quotient of these two equations to get:

(9.3%/100%) = X/140lb

Now we can isolate the variable X to get:

(9.3%/100%)*140lb = X = 13.02 lb

So this person has about 13.02 lb of hydrogen in his/hers body.

Solve for the area of the triangle in each of the following problems.

Answers

Answer:

area of triangle = 1/2×base×height

area of triangle =1/2×15m×16m

area of triangle =120m²

Helga buys a $64,987 car from a car dealership. The charge for freight is $2300. The car has an air conditioner and Helga will be getting a new licence plate, vehicle permit, and a licence plate registration sticker. What is the total cost of the purchase of the car?

Answers

The total cost of the car purchase, including the base price, freight charge, air conditioner cost, and license-related fees, is $68,937.

To calculate the total cost of the car purchase, we need to consider the base price of the car, the charge for freight, and the additional costs for the air conditioner and license-related fees.

Given:

Base price of the car: $64,987

Freight charge: $2,300

Additional costs:

Air conditioner cost: Let's assume it's $500 (not explicitly mentioned in the given information)

License-related fees: Let's assume it's $150 (not explicitly mentioned in the given information)

To calculate the total cost, we add up all the costs involved:

Total cost = Base price + Freight charge + Air conditioner cost + License-related fees

Total cost = $64,987 + $2,300 + $500 + $150

Total cost = $68,937

For more such question on cost. visit :

https://brainly.com/question/2292799

#SPJ8

Which of the following is equal to 5 1/3

Answers

Answer:

C

Step-by-step explanation:

The 3 would go on the outside.

The answer will most likely be c

Ashley is buying items for her dog Lance. She buys a dog collar for $6.50 and wants to buy dog food at $4 a pound. If she wants to spend exactly $22.50, how many pounds of dog food can she afford? Which equation model this situation? *
1 point
4lbs : 6.50x + 22.50 = 4
5lbs : 4x + 6.50 = 22.50
4lbs : 4x + 6.50 = 22.50
4lbs : 4 + 6.50x = 22.50

Answers

Answer:

4 lbs : 4x + 6.50 = 22.50

Subtract 6.50 from 22.50 and divide the remaining number by 4.


Kacie has a bag of
pretzels. She eats 1/3 of
the bag and gives 1/2 of
the bag to her brother.
How much of the bag
does she have left?

Answers

Answer: .

Step-by-step explanation:

Jimmy is writing a paper for one of his classes. The paper has to be 2,000 words long, and so far he has written 432 words. If
he only has 4 more days to write his paper and wants to write the same number of words each day, then how many words
must he write per day to finish the paper?

Answers

392 words per day for the following 4 days

PLS HELP !!!

Fiona spent 50 minutes to complete her homework. She spent 30 minutes on her
math assignment and 20 minutes on her science assignment. What fraction of time
did Fiona spend on her math assignment??

Answers

The answer you’re looking for is 3/10

Answer:

3/5 of her time

Step-by-step explanation:

She spent 30 minutes out of 50 minutes on her math assignment. So, we can write this fraction:

30 minutes / 50 minutes

Divide both the numerator (top of the fraction) and denominator (bottom of the fraction) by 10 minutes to get

3 / 5

So, the answer is 3/5 of her time.

What is the volume of the figure? ​

Answers

The volume of a figure is the number of cubes required to fill it completely, like blocks in a box. Volume of a cube = side times side times side. Since each side of a square is the same, it can simply be the length of one side cubed

Determine the equation of the graph, and select the correct answer below.

Answers

9514 1404 393

Answer:

  (b)  y = (x +4)² -1

Step-by-step explanation:

The vertex form of the equation of a parabola is ...

  y = a(x -h)² +k . . . . . . . . . vertex (h, k); scale factor 'a'

The graph shows the vertex is (h, k) = (-4, -1) and a=1. Putting these values into the form, we have ...

  y =(x +4)² -1

What is the volume of a rectangular crystal with a length (1) of 2.2 cm, a width (w) of 2 cm, and a height
(h) of 1.8 cm?

Answers

Answer:

7.92 cm^3

Step-by-step explanation:

To find volume all you have to do is multiply the length, width, and height. The answer would be: l * w * h = 2.2 * 2 * 1.8 = 7.92 cm^3.

I just need help finding out the missing sides

Answers

DON'T OPEN IT, IT'S A VIRUS!!
Other Questions
Write chemical equations for the following reactions. Classify each reaction into as many categories as possible: 15) Water and dinitrogen pentoxide gas react to produce aqueous hydrogen nitrate.Write chemical equations for the following decomposition reactions. 18) Aluminum oxide (s) decomposes when electricity passes through it.Predict whether the following single-replacement reactions will occur. If a reaction occurs, write a balanced equation for the reaction. 21) K(s)+ZnCl_2(aq)->, 24)Al(s)+Pb(NO_3)_2(aq)-> (symbol _ represent a subnumber).Write the balanced chemical equations for the following double-replacement reactions. 25) The two substances at right react to produce solid silver iodide and aqueous lithium nitrate. A treaty that can be signed between two or more countries to lower tariffs and improve the import and export of goods is a free trade.a. Trueb. False Ali will repair his car tomorrow (change into causative)?What is the answer? Population density is a measurement of population per unit area or unit volume.A TrueB False Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3 Alfred Kinsey argues that human sexuality a. can be studied scientifically, by collecting a broad range of data about what humans actually do sexually. b. is a moral matter and therefore is not an appropriate matter for scientific investigation. If investor's revise their expectations and now expect that Canada's inflation rate will increase over the next ten years, what impact will this have on the slope of the yield curve? Briefly explain #I X Haba una vez una princesa muy hermosa. Pero un da una bruja muy mala le puso una maldicin. Su padre el rey empez a buscarla en la noche y el da. Poco saban que ella estaba en un castillo muy lejos. Un da un chico precioso paso por el castillo. La princesa lo sigui mientras el chico se iba a su casa. Todos los das ellos hablaran mucho hasta que un da se enamoraron y vivieron feliz para siempre. Can someone help fix this my teacher said its missing accents and that theres a better word for spell or curse. The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.What is the residual value when the price of jeans is $28.00?A)9.37B)1.13 C)1.13D)9.37 A researcher was interested in seeing if cats or dogs are more playful with their owners overall. The null hypothesis of this study isa. dogs will play with their owners more than catsb. cats will play with their owners more than dogsc. cats and dogs play with their owners at the same rated. more information is needed why could one argue that the typical word superiority effect findings are counter intuitive We do solemnly and mutually in the presence of God, and one of another, covenant and combine ourselves together into a civil body politic, for our better ordering and preservation. Which of the following is a true statement about the quote? This is a quote from the Mayflower Compact and reflects the principle of self-government. This is a quote from the Magna Carta and reflects the principle of limited monarchy. This is a quote from Common Sense and explains why the American colonists should declare independence. This is a quote from the English Bill of Rights and describes the basic rights of all citizens. PLEASE HELP! IM LIKE STUCK AND I NEED HELP! YOU'LL GET 50 POINTS !!!! what signals the end of the cell cycle i. Solar cells are marketed (advertised) based upon their maximum open-circuit voltages and maximum short-circuit currents at Standard Test Conditions (STC). A. What is the definition of STC for a solar panel?B. From what you measured how would you "advertise" the capability of this solar cell? C. Why are your maximum measured values not necessarily representative of the how a solar cell is actually used? ii. If the same light source were moved farther away, how would this affect the current and voltage measured at the output of the solar panel? Explain why. ii. If the same light source is used, but the solar panel temperature is much hotter, how would this affect the current and voltage measured at the output of the solar panel? Explain why. iv. If you were given access to multiple solar panels of the same model, design a circuit to achieve: A. 3 times more current B. 3 times more voltage A function is defined by f(x) = x+2, 0. A region R is enclosed by y = f(x), the y-axis line y = 4.Find the exact volume generated when the region R is rotated through 27 radians about the y-axis. Hi 123-123+123+123=???? Which of the following expressions are equivalent to 10 12? Choose all answers that apply: . 2.5 - 6 B.2(5 - 6) C.None of the above Approximately how many Tejanos(Mexicans living in Texas) were livingthere around 1800?A. 3000B. 10,000C. 22,000 Required information Skip to question [The following information applies to the questions displayed below.] The December 31, 2021, adjusted trial balance for Fightin' Blue Hens Corporation is presented below. Accounts Debit Credit Cash $ 10,400 Accounts Receivable 134,000 Prepaid Rent 4,400 Supplies 22,000 Equipment 240,000 Accumulated Depreciation $ 119,000 Accounts Payable 10,400 Salaries Payable 9,400 Interest Payable 3,400 Notes Payable (due in two years) 24,000 Common Stock 140,000 Retained Earnings 44,000 Service Revenue 340,000 Salaries Expense 240,000 Rent Expense 12,000 Depreciation Expense 24,000 Interest Expense 3,400 Totals $ 690,200 $ 690,200 Required: 1. Prepare an income statement for the year ended December 31, 2021.