At the end of the video, the man getting interviewed provides an analogy about meditation and states of matter. Create your own analogy that explains the differences between the behavior of molecules in different states of matter. Explain.

Answers

Answer 1

Marathon runners well exhibit the differences between the behavior of molecules in different states of matter.

At the starting point before the start of the race, the runners would gather in a common place before the starting line. They would be close to each other and are tightly packed like solid molecules.

After the race was started, some players would start to move fast and some remain in a group for a certain period. They were loosely packed compared to solid.

As the game reaches the end point, the players would be more spread out based on their stamina. They would be more loosely packed compared to solid and liquid.

To know more about Matter

https://brainly.com/question/10893210

#SPJ1


Related Questions

Help, how to solve? - The question underneath, why is it Option C (4.8*10^23 ions) and not option B (1.2*10^23 ions). How do we solve and approach the question?

Answers

Option C (4.8 × 10²³ ions) is correct not option B (1.2 × 10²³ ions) as one molecule of (NH₄)₃PO₄ contains four ions, three NH₄⁺, and one PO₄⁻³.

To calculate ions, first, we have to calculate number of molecules of (NH₄)₃PO₄ in 0.20 moles.

To calculate number of molecules, the number is moles is multiplied by Avogadro number (6 × 10²³).

So, the number of molecules of (NH₄)₃PO₄ in 0.20 moles is,

Number of molecules = 0.20 × 6 ×10²³ = 1.2 × 10²³

One molecule of (NH₄)₃PO₄ contains three ions of NH₄⁺, and one ion of PO₄⁻³. So, number of ions in 0.20 moles of (NH₄)₃PO₄ are

Number of ions = 4 × 1.2 × 10²³ =4.8 × 10²³

Learn about the difference between number of molecules and atoms at:

https://brainly.com/question/12515630

#SPJ1

Describe these three experiments which have been used to support the atomic theory: Cathode Ray Tube, Gold Foil Experiment, and Atomic Emission Spectra.

Answers

The atomic theory developed along the experiments of the  Cathode Ray Tube, Gold Foil and Atomic Emission Spectra.

What is the atomic theory?

The term atomic theory has to do with the arrangement of the particles that compose the atom. Let us look at the development of the atomic theory chronologically.

Cathode Ray Tube - In the cathode ray tube, J.J Thompson was able to pass  an electric discharge through the tube and a color was observed that corresponds to the gas in the tube.

Gold foil experiment - Here, thin gold foils were bombarded with alpha particles and the movement of the alpha particles were tracked.

Atomic emission spectra - Here, electrons were excited to different wavelengths and the corresponding spectra was observed.

Learn kore about atomic theory:https://brainly.com/question/28853813

#SPJ1

What is the lithosphere? ) (25 pts)

Answers

The rigid outer part of the earth, consisting of the crust and upper mantle.

Why does H2O(s) floats on H20(l) when both are at 0c

Answers

H2O(s) floats on H2O(l) when both are at 0°c because ice is lighter than water which causes water to displace ice.

The density of a substance is calculated by the ratio of the mass of the substance to the volume of the substance.

Ice structure is cage like with more intermolecular spacing and Hydrogen bonds are stable. Water structure is linear and Hydrogen bonds form and reform. It causes more volume for same mass in ice and less volume for same mass in water.

At 0°C the density of ice is less than density of water. At 0°C, density of water is 1.0 gm/cm³ and density of ice is 0.931 gm/cm³, so water causes ice to displace resulting in ice floating over the water.

Learn about the relation between volume and density of ice and water at:

https://brainly.com/question/11184327

#SPJ1

a hydrogen atom emits a photon. you are given the wavelength of the photon. what sign will the energy of the photon be calculated as?

Answers

The energy of the photon to will be calculated by using E=hv.

Photons are fundamental subatomic particles that carry electromagnetic force — or, to put it another way, they are light particles. The energy of a photon is calculated by determining the wavelength of the photon. To do this, we need to know the frequency of the light and its speed in a vacuum.

A hydrogen atom emits a photon with a frequency of about 6.6x1014 Hz and a speed in a vacuum of 3.0x108 m/s.

The value for E = hν is:

E = hν

= Planck's Constant × Frequency × Wavelength

= hc/(2π×frequency × wavelength)

The unit of energy is given by Joules(J).

To learn more about photon visit: https://brainly.com/question/20912241

#SPJ4

When calcium reacts with chlorine to form an ionic compound, each metal atom loses electron(s) and each nonmetal atom gains electron(s). there must be calcium atom(s) for every chlorine atom(s) in the reaction.

Answers

When calcium reacts with chlorine, each calcium atom loses 2 electrons, and each chlorine atom gains 2 electrons. There must be one 1 calcium atom for every 2 chlorine atoms in the reaction.

When atoms react, they either lose or gain electron. Atoms do this in order to attain the stable noble gas configuration. Metals are more likely to lose electrons, and non-metals are more likely to gain electrons. Calcium has an atomic number of 20, and its electronic configuration is:

[Ca] = 1s²2s²2p⁶3s²3p⁶4s²

The easiest way for calcium to obtain a stable noble gas configuration is to lose 2 of its electrons, so that it has 18 electrons left. When this happens, calcium becomes a positively charged cation:

Ca ⇒ Ca²⁺ + 2e⁻

Chlorine has 17 electrons with the electronic configuration:

[Cl] = 1s²2s²2p⁶3s²3p⁵

This shows that chlorine only needs one electron to have the stable noble gas configuration. When this happens, chlorine becomes a negatively charged anion:

Cl + 1e⁻ ⇒ Cl⁻

Thus, for calcium to completely react with chlorine, there must be two atoms of chlorine for each carbon atom. This is because calcium loses two electrons, and each chlorine atom only accepts one. Hence:

   Ca²⁺ + 2CL⁻ ⇒ CaCl₂

Learn more about atoms here:

https://brainly.com/question/15170320

#SPJ4

the reaction 2a → a2​​​​​ was experimentally determined to be second order with a rate constant, k, equal to 0.0265 m–1min–1. if the initial concentration of a was 3.75 m, what was the concentration of a (in m) after 180.0 min?

Answers

Based on the integrated equation used for reactant concentration calculation in a second-order reaction and the data given (initial concentration, reaction rate constant, and time elapsed), the concentration of A after 180.0 min will be 0.20 M.

The integrated equation for the reactant concentration in a second-order reaction looks like this:

1/[A] = kt + 1/[A]₀

k - reaction rate constant (0.0265 min⁻¹M⁻¹)

[A]₀ - initial concentration (3.75 M)

t - time elapsed (180.0 min)

1/[A] = 0.0265 min⁻¹M⁻¹ * 180.0 min + 1/(3.75 M) = 4.77 M⁻¹ + 0.27 M⁻¹ = 5.04 M⁻¹

[A] = 1 / (5.04 M⁻¹) = 0.20 M

You can learn more about second-order reactions here:
brainly.com/question/12446045

#SPJ4

i am pouring concentrated sulfuric acid from a 1-gallon container. i need to use the following ppe for protection against potential splash of a corrosive liquid.

Answers

Personal protective equipments to be worn while handling corrosive liquids are safety goggles, hand gloves  and closed toed shoes.

What are personal protective equipments ?

Personal protective equipment is a protective clothing which is worn to protect the wearer's body  from hazard or injury.The hazards which can be addressed  by the use of personal protective equipment are physical,chemical and bio hazards.

It imposes a barrier between the user and the working environment.The main purpose of personal protective equipment is to reduce exposure of employees to the hazards.

It has a limitation that it does not eliminate the hazard and may lead to harm to the employee if the equipment is damaged.

Learn more about personal protective equipment,here:

https://brainly.com/question/28900790

#SPJ1

1. using your titration data, calculate the %na2co3 for each trial, the average %na2co3 and standard deviation. 2. describe how to obtain a second derivative plot. 3. why is potentiometry used to detect the endpoints for this titration? could color indicators have been used?

Answers

Simply subtract the differences in the first derivative values from the differences in the midpoint volumes to obtain the second derivative, and then plot this value at the intersection of the two midpoint volumes.

Potentiometric titration is a laboratory method to determine the concentration of a given analyte.

Na2CO3 and NaHCO3 concentration in a mixture can be determined by accurately weighing 2.0 g of the mixture and making a distilled water solution in a 250 ml standard flask. Use phenolphthalein as an indicator while you gradually titrate 25 ml of this solution against regular hydrochloric acid. To concord, repeat (Vp ml).

In order to locate the equivalency more precisely, a second derivative plot is also generated. point—where the extrapolated line intersects the x-axis (graph 4). A highly precise value for the volume of titrant can be acquired because the x-axis indicates the volume of titrant utilized.

Potentiometric titration is one of the chemical methods of analysis, and it involves adding a titrant with a known concentration and measuring the endpoint of the titration with an indicator electrode that records the change in potential as a function of the amount (often the volume) added.

To learn more about Potentiometric titration visit:https://brainly.com/question/28855227

#SPJ4

Copper(II) oxide can be reduced by hydrogen:
CuO(s) + H2(g) → Cu(s) +H2O(g)
What mass of copper can be obtained from 15.9 g of copper(II) oxide?

Answers

Answer:

do that in calc

Explanation:

mass of cu = 63.55 ÷ 79.55 × 15.9

Match the structural formulas given to you below with the correct chemical formula from the bank above. (Image provided)

Answers

1) C3H6O because there are 6 hydrogen in formula and one oxygen. 2) H2So4 sulphric acid.  

What three categories exist for chemical formulas?

Chemical formulas can be divided into three categories: empirical, molecular, and structural. Molecular formulas display the quantity of each type of atom in a molecule, while structural formulas display the simplest whole-number relationship between the atoms in a compound. Empirical formulas display the simplest whole-number relationship between the atoms in a compound.

3) C2H2 ethyne where carbons have triple bond.

4) CO carbon monoxide where C and O have triple bond between them  .

5) HNO3 is nitric acid .

6) CH2F2

7) Ch2O

8) C2H4 is ethene in which carbon carbon have double bonds.

9) SO3 sulphur trioxide.

10) CH3F

To learn more about chemical formula refer

https://brainly.com/question/11995171?

#SPJ4

2. Explain the significance of the discovery of gallium (mass number 68) to Mendeleev periodic table

Answers

The significance of gallium is explained below

Describe gallium.

The atomic number and symbol for the chemical element gallium are 31. The discovery was discovered in 1875 by French chemist Ga. Paul-Émile Lecoq de Boisbaudran. Gallium is a similar metal to the other elements in Group 13 of the Periodic Table (aluminium, indium, and thallium).

Under normal pressure and temperature, gallium is a soft and silvery element. When it's liquid, it takes on an icy white hue. Using too much force could cause gallium to shatter conchoidally. Since its discovery in 1875, gallium has been frequently used to produce alloys with low melting points. It is also used in semiconductors as a dopant on semiconductor substrates.

In 1875, a French chemist by the name of Paul Emile Francois Lecoq de Boisbaudran made a spectroscopic discovery of a new element while studying zinc blende. The properties of this freshly discovered element matched those of the eka-aluminum, which has an atomic weight of 69, as predicted by Mendeleev. The specific gravity of the element was later determined to be 5.9, as predicted by Mendeleev. The substance was then given the name gallium by Lepoq, who so elevated Mendeleev's periodic table and supported Mendeleev's theories.

To know more about gallium, click on the link

https://brainly.com/question/13398355

SPJ10

a student is running an experiment in which 42.0 grams of coso4 is needed, but the only jar of reagent in the lab is labelled cobalt(ii) sulfate hexahydrate. how many grams of the hydrate must the student weigh out in order to get the desired amount of the anhydrous compound?

Answers

A mass of 71.26g of [tex]CoSO_4.6H_2O[/tex] is required to get 42g of the anhydrous compound, i.e., [tex]CoSO_4[/tex].

A compound's molar mass indicates the mass of one mole of that substance. In other words, it informs you how many grams of a substance there are per mole. A covalent compound's formula mass is also known as its molecular mass. The mole is a useful quantity unit for representing very large quantities of atoms or molecules. A substance's molecular mass is the total of the atomic masses of all the atoms that comprise the molecule of the substance.

The term anhydrous means "without water." Anhydrous chemicals are compounds that do not contain water or do not contain water. An anhydrate is formed when water is removed from a hydrate. Suction or high-temperature heating of the chemical removes the water molecules. An anhydrous salt, for example, has had water driven out of its crystals.

Given:

Mass of [tex]CoSO_4[/tex] needed = 42g

To find:

Mass of [tex]CoSO_4.6H_2O[/tex] = ?

Formula:

Mass of [tex]CoSO_4.6H_2O[/tex] = (Mol. Wt. of [tex]CoSO_4.6H_2O[/tex] / Mol. Wt. of [tex]CoSO_4[/tex]) x Mass of [tex]CoSO_4[/tex]

Calculations:

Mol. Wt. of [tex]CoSO_4[/tex] = 155g/mol

Mol. Wt. of [tex]CoSO_4.6H_2O[/tex] = 155 + 6 x 18 = 263g/mol

Mass of [tex]CoSO_4.6H_2O[/tex] = (263 / 155) x 42

Mass of [tex]CoSO_4.6H_2O[/tex] = 71.26g

Result:

71.26g of [tex]CoSO_4.6H_2O[/tex] is required to get 42g of the anhydrous compound.

Learn more about Mass of an anhydrous compound here:

https://brainly.com/question/8916538

#SPJ4

a 30.84 ml volume of 0.128 m naoh is required to reach the phenolpthalein endpoint in the titration of a 5.441 g sample of vinegar. calculate the percent acetic acid in the vinegar.

Answers

The percentage of acetic acid in vinegar is 4.36%

What is acetic acid?

The scientific name for acetic acid is ethanoic acid. It is an acidic, colorless liquid organic substance having the formula CH3COOH. Vinegar has a minimum of 4% acetic acid by volume, making acetic acid the primary component of vinegar besides water and trace elements.

Given,

Volume=  30.84 ml

Moles= 0.128

mass of vinegar= 5.441g

moles NaOH = 0.03084 ml x 0.128

M=0.00395

mass acetic acid = 0.00395 mol x 60.05 g/mol=0.237 g

Percentage of acetic acid:

= 0.237 x 100/ 5.441

= 23.7/5.441 = 4.36%

Hence, The percentage of acetic acid in vinegar is 4.36%

To learn more about percentage problems the link is given below:

https://brainly.com/question/14356148?referrer=searchResults

#SPJ4

how to identify oxides that don't dissolve in water?

Answers

Answer: The oxides of hard metal or the transition metals oxides like oxides of copper, zinc, iron, and chromium do not dissolve in water due to their limited basicity. Alkaline earth metal oxides also form hydroxides in water but these hydroxides themselves give slaked solutions and are not completely soluble.

Explanation: The oxides of hard metal or the transition metals oxides like oxides of copper, zinc, iron, and chromium do not dissolve in water due to their limited basicity. Alkaline earth metal oxides also form hydroxides in water but these hydroxides themselves give slaked solutions and are not completely soluble.

Why are race cars and bicycles made of lightweight materials?

Answers

For less traction…..

why would air moving over a cold current cause fog (advection fog)? group of answer choices the cold current produces the fog when kelp beds release condensation nuclei. all of the other answers are correct, and thus this is the best answer the cold current produces the fog by mixing with the air. the air is chilled, which decreases the capacity of air to hold water vapor, and eve

Answers

The correct answer is option  C.

The air moving over a cold current cause fog or advection fog when the air is chilled, which decreases the capacity of air to hold water vapor, and eventually, the relative humidity reaches 100% - leading to condensation and fog formation.

What is advection fog?

When warm- moist air or warm air front slides over the cold air front or cold surface, it results in the formation of advection fog.

Resultantly, the air becomes saturated and chilled at high humidity levels due to which water vapors start to condense leading to fog formation.

Moreover, the optimal condition for the formation of advection fog is cloudy windy weather having moderate to powerful winds.

If you want to learn more about advection fog click here:

https://brainly.com/question/18803983

#SPJ4

The complete question is:

Why would air move over a cold current cause fog (advection fog)?

(a)  the cold current produces the fog when kelp beds release condensation nuclei.

(b)  the cold current produces the fog by mixing with the air.

(c) the air is chilled, which decreases the capacity of air to hold water vapor, and eventually, the relative humidity reaches 100% - leading to condensation and fog formation.

A river flows at a rate of 57.3m/sec, what is the rate when it is converted to km/day? Please answer fast!!!

Answers

4950.72 hope this helps

Write the electron configuration (1s², 2s²,...) for the following:
Hydrogen
2
Fluorine
Boron - 1s²2s²2p¹
3 Aluminum
Draw the electron configuration with the correct atomic orbitals for the following:
4 Sodium
6
5 Sulfur
Boron-
Argon
15². 25
2p

Answers

that is for hydrogen, fluorine and aluminium

cheggin the experiment to determine which mechanism was used by restriction endonucleases, what evidence ruled out the formation of a covalent intermediate?

Answers

The covalent phosphodiester bonds of DNA are hydrolyzed by restriction enzymes, leaving either "sticky/cohesive" ends or "blunt" ends.

By incubating the target DNA molecule with restriction enzymes, which detect and bind certain DNA sequences and cleave at specified nucleotides either inside or outside of the recognition sequence, restriction digestion is carried out.

An isolated bacterial protein known as a restriction enzyme cleaves DNA at sequence-specific locations to create DNA fragments with a known sequence at either end. Restrictions enzymes are crucial for numerous laboratory processes, including recombinant DNA technology and genetic engineering.

At the particular restriction site, DNA bonds between the 3′ OH of one nucleotide and the 5′ phosphate of the following one are cleaved by restriction enzymes.

In order to prevent the plasmid vector from ligating with itself and to verify that the inserted gene is oriented correctly, two separate restriction enzyme sites might be used.

A) #1 5′ - CGTGATCTCGATTCGCTAGTAACGTT - 3′

         3′ - GCACTAGAGCTAAGCGATCATTGCAA - 5′

    #2 5′ - TCATGAATTCCTGGAATCAGCAAATGCA - 3′

         3′ - AGTACTTAAGGACCTTAGTCGTTTACGT - 5′

B) Recognition sites:

#1 5′ - GAATTC - 3′

    3′ - CTTAAG - 5′

#2 5′ - GAATTC - 3′

    3′ - CTTAAG - 5′

C) Cleavage sites:

#1 5′ - G    AATTC - 3′

    3′ - CTTAA    G - 5′

#2 5′ - G    AATTC - 3′

    3′ - CTTAA    G - 5′

The correct and complete question is in the image.

Learn more about Restriction enzymes here:

https://brainly.com/question/13944056

#SPJ4

What is the speed of a car that travels 45 miles in 45 minutes? Answer in miles per hour.

Answers

Answer:60 miles in one hour

Explanation:

you have two test tubes. one test tube contains fe 3(aq) solution and the other test tube contains ni 2(aq). predict what will happen when naoh(aq) is added to both test tubes. if a reaction occurs, what is the new chemical formula?

Answers

The new chemical formula is [tex] Fe(OH)_{3}[/tex] or ferric hydroxide.

Ion [tex] {Fe}^{3 + } [/tex] will react with NaOH while [tex] {Ni}^{2 + } [/tex] will not. The chemical reaction is as follows -

Chemical reaction stating reaction between [tex] {Fe}^{3 + } [/tex] and NaOH.

[tex] {Fe}^{3 + } [/tex] + NaOH → [tex] Fe(OH)_{3}[/tex] + Na

In the reaction, [tex] {Fe}^{3 + } [/tex] represents ferric ions, NaOH is the chemical formula of sodium hydroxide, [tex] Fe(OH)_{3}[/tex] is the chemical formula of ferric hydroxide and Na represents sodium. The ferric hydroxide precipitates as reddish brown. It does not dissolve in excess is sodium hydroxide.

Chemical reaction stating reaction between [tex] {Ni}^{2 + } [/tex] and NaOH

Nickel does not react with sodium hydroxide due to its basic nature. The reason can be owed to electron donating characteristic of both the metal and base.

Learn more about metal and sodium hydroxide reaction -

https://brainly.com/question/25597694

#SPJ4

What is the volume of 2.00 moles of an unknown gas at STP?
O2.00 L
0 11.2L
0 44.8L
O 22.4L

Answers

should all countries provide free universal healthcare to all its citizens? Why or why not? Explain.provide a film review that explains your opinion about the documentary

How many joules of heat are needed to change 50.0 grams of ice at -15.0 C to steam at 120.0 C

Answers

The answer is

153.7kJ.

The total energy needed for the water molecules to transition from ice to water and subsequently from water to vapor is what you are asked to calculate.

In order to do this, you'll need to know:

Heat of fusion of water:  ΔHf = 334J/g;

Heat of fusion vaporization of water: ΔHv = 2257J/g;

Specific heat of ice: c = 2.09J/g∘C;

Specific heat of water: c = 4.18J/g∘C;

Specific heat of steam: c = 2.09J/g∘C;

So, the following steps describe the overall process:

1. Calculate the amount of heat needed to raise the ice's temperature from − 15.0∘C to 0∘C:

q1 = m ⋅ Cice ⋅ ΔT = 50.0g ⋅ 2.09J/g⋅∘C ⋅ (0∘C−(−15∘C)) = 1567.5J

2. Calculate the amount of heat needed to convert 0∘C ice to 0∘C water:

q2 = m⋅ ΔHf = 50.0g ⋅ 334J/g = 16700J

3. Calculate how much heat is needed to evaporate water at 0∘C to water at 100∘C:

q3 = m ⋅ Cwater ⋅ ΔT = 50.0g ⋅ 4.18J/g⋅∘C ⋅ (100∘C−0∘C) = 20900J

4. Calculate the amount of heat needed to convert 100∘C water to 100∘C vapor:

q4 = m ⋅ ΔHv = 50.0g ⋅ 2257J/g = 112850J

5. Identify the heat needed to transition from 100∘C vapor to 120∘C vapor:

q5 = m ⋅ Cvapor ⋅ ΔT = 50.0g ⋅ 2.09J/g⋅∘C ⋅ (120∘C−100∘C) = 2090J

Therefore, the total heat required is

qTOTAL = q1 + q2 + q3 + q4 + q5 = 152696.5J = 153.7kJ

Lets learn more about similar numericals

https://brainly.com/question/9764207

What mass of HCI is needed to
generate 45.2 g of AICI3?
2AI + 6HCI → 2AlCl3 + 3H₂
AICI3: 133.33 g/mol
HCI: 36.46 g/mol

Answers

Answer:

37.1g of HCl

Explanation:

rate as brainliest

A student measures 25ml of acid into the flask and adds the 3 drops of the indicator. if the student then adds 20ml of water to the flask, will this change to amount of base needed to reach the endpoint?

Answers

The addition of water to the acid solution will change the molarity of the solution, but not the amount of base needed to reach the titration endpoint because the total amount of acid hasn't changed.

During this titration, a solution of the base will be added to a solution of the acid, and when the endpoint is reached, the indicator will change color. The titration endpoint is reached when the acid in the sample solution has been completely neutralized, and an excess base is now appearing.

The amount of base required for neutralization is determined by the amount (number of moles) of acid in the starting solution. Although the starting solution would become more dilute (lowering its molarity) upon the addition of water, the total amount of acid will not be reduced, thus requiring the same amount of base.

You can learn more about molarity here:
brainly.com/question/16727614

#SPJ4

An atom of Gold contains 120 neutrons. What is its mass number?

Answers

Answer:

199

Explanation:

Au has atomic number of 79

so mass number = 79 + 120 = 199

Look at the two waves shown. What is the speed of each wave?

Answers

The speed of all electromagnetic waves is equal to the speed of light that is 3 × 10⁸ m/s.

What is an electromagnetic wave?

An electromagnetic wave is a wave of certain wavelength of an electromagnetic radiation of the electromagnetic spectrum. There are different types of waves in the spectrum like IR, radio waves etc.

The speed of c of the wave is the product of its frequency and wavelength. The speed of all electromagnetic waves are equal to the speed of visible light.

Hence, the speed of both waves is 3 × 10⁸ m/s.

To learn more about the electromagnetic waves, refer the link below:

https://brainly.com/question/3101711

#SPJ1

why do you like homo and heterogen mixtures?

Answers

Homogeneous are hard to seperate but heterogeneous are easy to seperate.

What role does heterogeneous mixture have in daily life?

Every day, humans employ heterogeneous mixes that can be found all around them. Particles in heterogeneous mixtures can be recognized after mixing and still maintain their chemical characteristics. Filtration and chemical processes can be used to separate the components of heterogeneous mixes.

All substances exist in one state of matter, which is a homogenous mixture. Solids can combine uniformly with other solids, liquids can combine with other liquids, and so on.

On the other hand, a heterogeneous mixture (derived from the Greek word "hetero" for dissimilar) has a non-uniform composition, which means that different parts may contain more or less of a given component. A heterogeneous mixture allows for the simultaneous existence of solid, liquid, and gas phases as well as other states of matter.

To learn more about

heterogeneous mixture refer

https://brainly.com/question/24898889?

#SPJ13

Which of the following samples can be considered as a concentrated
solution of Povidone Iodine, an antiseptic for minor wounds ?

A. 3 drops of Povidone Iodine dissolved in 100 ml of water.

B. 5 drops of Povidone Iodine dissolved in 100 ml of water.

C. 10 drops of Povidone Iodine dissolved in 100 ml of water.

D. 50 drops of Povidone Iodine dissolved in 100 ml of water.

Answers

The sample that should be considered concentrated solution of Povidone Iodine is 50 drops of Povidone Iodine dissolved in 100 ml of water. That is option D

What is a concentrated solution?

A concentrated solution is defined as the type of solution that contains more dissolved solute with less solvent when compared with other solutions.

A solute is defined as the part of a solution that dissolves in a solvent while the solvent is part of the solution that is the dissolving medium.

From the options listed, the most concentrated solution is the solution that contains more of the povidone iodine which is 50 drops of Povidone Iodine dissolved in 100 ml of water.

Learn more about solvent here:

https://brainly.com/question/26429686

#SPJ1

Other Questions
Using a trigonometric ratio to find an angle measure in a right In the 1950's, the U.S. government blacklisted both members and suspected members of what group of people? What is the equation of the following line written in slope-intercept form.y = 2 /3 x + 9 /2y = 3 /2 x - 9 / 2y = - 3 /2 x - 3 / 2 Suppose contact lenses cost $300 for a years supply or $30 for a months supply. Which is less expensive to order per year, paying for 12 months at one time or paying for 1 month at a time? Is the sequence {3, 6, 12, 6, 3, ...} a function? Explain. If 12 + _ = 0 + 12, then _ must equal:A: 120B: 12C: 1D: 10E: 0 Given the graph of f (x), determine the domain of f 1(x). Radical function f of x that increases from the point negative 3 comma negative 2 and passes through the points 1 comma 0 and 6 comma 1 What is the portion of the parliamentary procedure contest in which all six students conduct a chapter meeting and demonstrate their knowledge of parliamentary law using the given motions?. if the nutrition facts panel on a food label indicates that a food has 24 g of total carbohydrates, 2 g of fiber and 12 g of sugar, what is the total amount of carbohydrates in this food? All of the following were part of theoriginal group that created the Declaration of Independence except for?A. John AdamsC. Ben FranklinB. Richard Henry LeeD. Paul Revere 2. Hoag hopes that Dr. Potbury will inform him that the substance under hisfingernails is blood. When he is informed that this is not the circumstance, he isdesperate to know its true nature. Speculate as to what it could possibly be.| Which of the following would be a typical application of gamma radiation?Killing cells and organismsProducing fluorescenceHeating objectsTransmitting signals between Earth and space Living things need __________ for thinking, eating and moving Mr. Charles drinks 8 glasses of water each day. Each glass contains 240ml. How manymillimeters of water does he drink in a week? State whether the Law of Detachment, the Law of Syllogism, or the Law of theContrapositive was used to draw the conclusion from the given statements. If it's aninvalid conclusion, write invalid.If you go fishing, then you will need to bring your fishing rod.If you go fishing, then you will need to bring bait.Therefore, if you bring your fishing rod, then you will need to bring bait.Law of DetachmentLaw of SyllogismLaw of ContrapositiveInvalid Conclusion Solve the following problem using substitution or elimination method. Two rental car companies are running specials this month. At Johnsons Rentals, customers will pay $50 to rent a mid-sized car for the first day, plus $2 for each additional day (x). At Martinez Rent-a-Car, the price for a mid-sized car is $30 for the first day and $4 for each additional day (x). How many additional days (x) would it cost the same to rent from either company? What is that cost?Let x represent the number of additional days you will rent a car and y represent the total cost of renting the car. Write a system to represent the situation, and solve to answer the question. use lagrange multipliers to prove that the rectangle with maximum area that has a given perimeter p is a square. let the sides of the rectangle be x and y and let f and g represent the area (a) and perimeter (p), respectively. find the following. Determine the x-intercepts of the graph represented by the following quadratic function. Recall that y = f(x).f(x) = x2 4x 21(x, y) = (smaller x-value)(x,y)= (larger x-value) In a newspaper, it was reported that yearly robberies in Springfield were down 40% to 126 in 2013 from 2012. How many robberies were there in Springfield in 2012? The length of a rectangular billboard is 9 meters more than the width. If the perimeter is 42 meters find the dimensions.