f(x) = -3x – 1
g(x) = x2 + 6x – 12
Find: g(f(x))

Answers

Answer 1

Find g(f(x)) f(x)=3x^2+6x-4 g(x)=-3x+4. f(x)=3x2+6x−4 f ( x ) = 3 x 2 + 6 x - 4 g(x)=−3x+4 g ( x ) = - 3 x + 4. Set up the composite result function.


Related Questions

From 93 books to 144 books

Answers

51 Books

I think this is what you're looking for?

PLEASE NO LINKS AND NO NEGATIVITY

Answers

Answer:

B. Combine like terms

Step-by-step explanation:

Inside the parenthesis, they combined -2 and 6 to get a total of 4x

PLEASE HELP MEEEEEEEE
Step 6: Problem solving with presents

a) If the sales tax is 7% on all purchases, how much must you set aside for sales tax on $300? Show your work. (2 points)

Answers

7% of 100= 0.07
$300x0.07=$21
$300 of 7% sales tax is $21
$300+$21=$321 total purchase

Sierra left $17.75 as a tip for a waiter. This was 20% of the bill before the tip. How much was her total bill before the tip

Answers

Answer:

$31.95 Before tip.

Step-by-step explanation:

I believe you should just add 17.75+80%=31.95

17.75 / 0.2 = 88.75

Check: 88.75 x 0.2 = 17.75

What is the solution to -2(8x – 4) < 2x + 5?
o xs
oxca
O x>6
O x<6

Answers

[tex]-2(8x-4)<2x+5\\\\\implies -16x+8<2x+5\\\\\implies -16x+8-5<2x\\\\\implies 3<2x+16x\\\\\implies 3<18x\\\\\implies \dfrac3{18} <x\\\\\implies \dfrac 16 <x\\\\\implies x> \dfrac 16[/tex]

if m * n = √(m²-n²) then 5 * 3 = ​

Answers

[tex]m \cdot n = \sqrt{m^2 -n^2}\\\\\text{When m =5 and n =3,}\\\\\\5\cdot 3 = \sqrt{5^2 -3^2} =\sqrt{25 -9} = \sqrt{16} = 4[/tex]

[tex]\huge\text{Hey there!}[/tex]

[tex]\huge\textbf{Assuming:}[/tex]

[tex]\mathbf{m\times n = \sqrt{(m^2 - n^2)}}[/tex]

[tex]\huge\textbf{Solving:}[/tex]

[tex]\mathbf{\rightarrow 5\times 3 = \sqrt{(5^2 - 3^2)}}[/tex]

[tex]\mathbf{\rightarrow 15 = \sqrt{(5\times5 - 3\times3)}}[/tex]

[tex]\mathbf{\rightarrow 15 = \sqrt{(25 - 9)}}[/tex]

[tex]\mathbf{\rightarrow 15 = \sqrt{16}}[/tex]

[tex]\mathbf{15\neq4}[/tex]

[tex]\huge\textbf{Thus, this answer should be:}[/tex]

[tex]\huge\boxed{\boxed{\textsf{This statement is most likely: \boxed{\textsf{FALSE}}}}}\huge\checkmark[/tex]

[tex]\huge\text{Good luck on your assignment \& enjoy your day!}[/tex]

[tex]\frak{Amphitrite1040:)}[/tex]

At the deli 1 pound of turkey cost seven and 98 Mr. Epson 5 3 pound of turkey how much will the turkey cost

Answers

Answer:

42.29 READ THE EXPLANATION

Step-by-step explanation:

i am guessing you mean the cost for 1 pound is 7.98 and he is getting 5.3 but if different do the steps, all you have to do is mutiple the unit rate (7.98) by how many pounds bought(5.3)

Write a function rule for "The output is three times the input increased by two

A) y=5x
B) y=3x+2
C) y=3x - 2
D) y=2x+3

Answers

X is the input.

Three times the input would be 3x

Increased by two would be adding two at the end.

Answer: B. y = 3x + 2

When you purchase a car in the future, what are at least 3 things
you will have to think about first?

Answers

Answer:

How much it cost!? Will it fly?! How far will it fly?!

Step-by-step explanation:

Determine the unit rate. Use mental math when you can. 6 golf balls for $15

Answers

Answer:

1 golf ball : $2.50

Step-by-step explanation:

You can first divide 6 and 15 by 3, and get 2 and 5.Then, you divide 5 by 2, which is 2.5Therefore, the unit rate is 1 golf ball : $2.50

Mandy has $2.25 credit on her mobile phone. It costs $0.10 to send a text message. What is the largest amount of text messages she can possibly send to her friends with $2.25?

Answers

Answer:

22.5

Step-by-step explanation:

since 2.25 divided by 0.10 is 22.5 so she can message 22.5 friends

Fill in the table. What is the distance that David traveled going to his friend’s house and returning home?

Answers

Answer:12 and 12 hope this helps :)

Step-by-step explanation:

Answer:

mark her brialyist i cant spell lol

Step-by-step explanation:

subtract 3x-7x³+5x² from the sum of 2+8x²-x³ and 2x³-3x²+x-2​

Answers

Answer:

(2 + 8 x^2 - x^3) + (2 x^3 - 3 x^2 + x - 2) - (3 x - 7 x^3 + 5 x^2) = 8 x^3 - 2 x

Step-by-step explanation:

please help NEED NOW

thank youuu

Answers

A.

y= -2x + 4 is the answer

Answer: Answer A

Step-by-step explanation:

Since the y-intercept is 4 and the graph is rising to the left meaning there is a negative slope, the answer is A

The answer to the problem need quick

Answers

Answer:

1 3/4 + 1 5/12 + 2 1/3=5.5

5.5*10.5=57.75

Hope This Helps!!!

Complete all 4 problems

Answers

Answer:

7)-6a

8)7

9)x-1

10)8-k

Step-by-step explanation:

Here in every steps we took like terms to be added and finally there are no more like terms we cannot add nor subtract and we get answer

Answer:

7. -6a

8. 6x +5

9. x + 1

10. -k + 8

Step-by-step explanation:

7. A=1  1-7= -6  a - - 7a = -6a

8. 3x + 3x= 6x

6-1=5

6x+5

9. -8x + 9x = x

3-2 =1

x+1

10. 4+4 =8

k- 2k= -k

-k + 8

Elijah left his house at time zero and drove for 6 minutes to the store, at a speed of 1 blocks per minute. Then he stopped and went into the store for 6 minutes. From there, he drove in the same direction at a speed of 1 blocks per minute until he got to the bank, which is 3 blocks away from the store. He stopped at the bank for 7 minutes. Then he drove home at a speed of 3 blocks every minute. Make a graph of showing the number of blocks away from home that Elijah is xx minutes after he leaves his house, until he gets back home.

Answers

When plotting the graph, the times and distances Elijah drove are added

cumulatively on the horizontal and vertical axis of the graph.

Please find attached, the graph showing Elijah's distance from home in number of blocks, after he leaves his house.

Reasons:

The distances travelled by Elijah in the given times are as follows;

[tex]\begin{tabular}{|c|cc|} \underline{Time}&&\underline{Blocks away from home}\\0&&0\\6&&6\\12&&6\\15&&9\\22&&9\\25&&0\end{array}\right][/tex]

Using the above table, a graph can be plotted with MS Excel insert Chart function, to plot a Scatter with Straight Lines and Markers chart.

Please find attached the required graph showing Elijah's distance driven in

number of blocks away from his house, in xx minutes after he leaves his

house, until he gets back home created with MS Excel.

Learn more about plotting graphs here:

https://brainly.com/question/371134

Answer:

the answer is 5 hours 6 minutes 2 seconds

Step-by-step explanation:

formula of amount when interest and principal is given

Answers

Answer:

We can rearrange the interest formula, I = PRT to calculate the principal amount. The new, rearranged formula would be P = I / (RT), which is principal amount equals interest divided by interest rate times the amount of time.

Step-by-step explanation:

Hope this helps you sorry if it does not help you

Need the answer right now please help meeeeeeee

Answers

answer

2.5

Step-by-step explanation:

that is what I got so

PLEASE HELP ME I NEED HELP

Answers

Answer:

  3052.1 in³

Step-by-step explanation:

The volume of a sphere is given by the formula ...

  V = 4/3πr³ . . . . r is the radius

The radius is half the diameter, so is 9 in. Then the volume is ...

  V = (4/3)(3.14)(9 in)³ = 972(3.14) in³ ≈ 3052.1 in³

0.41g -2) + 1.2 =-(g-1) + 2.9​

Answers

Answer:

g=-3repeated

Step-by-step explanation:

calculate the volume of a cone with r=6.2 and h=10.9 and Pi=3.14

Answers

Answer: The volume(v) is 438.77.

Explanation: The formula for a right circular cone is in the image.

Every eight minutes the river raft can load 88 passengers what is the loading rate for passengers per minute

Answers

Answer:

11 passengers per minute.

Step-by-step explanation:

To find how many passengers board the boat in a minute, you'd have to divide 88 with 8.

88/8 = 11

To check:

11 passengers per min x 8 mins = 88 passengers.

which equation is equivalent to -2 (x+3) - 4x = 10?

Answers

Answer:

-6x -6= 10

Step-by-step explanation:

-2(x +3) -4x= 10

Expand:

-2(x) -2(3) -4x= 10

-2x -6 -4x= 10

Simplify:

-6x -6= 10

Thus, the second option is correct.

The sum and difference of two positive numbers are 15 and 5 respectively. Find the numbers.​

Answers

[tex]x+ y =15~~...(i)\\\\x-y = 5~~...(ii)\\\\\text{(i) +(ii):}\\\\x+y+x-y = 15+5\\\\\implies 2x = 20\\\\\implies x = \dfrac{20} 2 = 10\\\\\text{(i)-(ii):}\\\\x+y -x +y = 15 -5\\\\\implies 2y = 10\\\\\implies y=\dfrac{10}2 = 5\\\\\text{Hence the numbers are 10 and 5}[/tex]

PLEASE HELP ASAP 40 points Solve -2/3x > 8 or -2/3x < 4. {x | x > -12 or x < -6} {x | -12 < x < -6} {x | x < -12 or x > -6}

Answers

Your answer should be mx+b

2. What additional Information What additional information do you need to prove ABC = DEF by the SSS Postulate?

AC = DF
AB = DE
BC = EF

Answers

The answer is : Ab=De
We already know the other sides

Comparing Theater Sales
I need help A.S.A.P!!!

Answers

Step-by-step explanation:

oh come on ! you can see that with common sense : it is 2)

while the data itself is the same, but in figure B it is kind of suggested that "Super Cinema" had twice the sales of "Bud's Movies". which is not the case at all.

and that is one of the problems, when you don't show the whole data range (which happens when you don't start the data range at the actual beginning - like 0 in this case).

as I keep saying : never trust a statistic you have not falsified yourself ...

Holly spent a total of $28 to buy candy for his soccer team. He bought chocolate that cost $2 per bag and gummy that cost $3 per bag. There are 12 people on the team and each person only get one snack. x = bag of pretzel y = bag of chip
How many bars of chocolate did Holly buy?

Answers

Answer:

8 chocolate bars

Step-by-step explanation:

Write inequalities for the following:
A) AJ makes at least 20 dollars

B) Lyla has no more than 70 barrettes

C) Rook takes at most 6 presents

D) River gives no less than 8 bones

Answers

Answer:

AJ. x<20

Lyla. x> or equal to70

Rook. x>or equal to 6

River. x<8

I hope that this helped

Other Questions
As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg) Simplify this question Look at the circuit given below. It consists of a cell, a bulb with two terminals X, Y and wires. P, Q, R and S are positions marked. What is the direction of the flow of current? a) PQXYRS b) SRYXQP c) SPQXYR d) PSRYXQ WILL REPORT WRONG OR TROLL ANSWERS Which word in the passage most clearly shows the speaker's bias against the candidate? Senator Roberts has no experience as a county commissioner, and she is clearly hopeless. A. commissioner B. clearly C. hopeless O D. experience SUBMIT how long does it take from the time beans are planted until they are harvested Help help help please pelsss please You are pulling a child in a wagon. The rope handle is inclined upward at a 60 angle. The tension in the handle is 20 N.Part AHow much work does the rope do on the wagon if you pull the wagon 200 m at a constant speed? how to solve the following system y=(1/2)x^2+2x-1 and 3x-y=1