Earth scientists have concluded that the methods of harnessing energy that have been used over the past two centuries, such as the burning of fossil fuels, are causing climates around the world to change more quickly and suddenly than ever before in human history. Evidence includes increased air temperatures, rising sea levels, and the shrinking of glaciers in Greenland, Alaska, and other regions of Earth. The most complex level of organizational hierarchy that climate change could potentially affect is Earth’s
biosphere.
communities.
organisms.
populations.

Answers

Answer 1

The most complex level of organizational hierarchy that climate change could potentially affect is Earth's biosphere.

What is biosphere?

The biosphere refers to the global ecological system that encompasses all living organisms and their interactions with the physical environment. It includes various interconnected ecosystems, such as forests, oceans, grasslands, and deserts, along with the diverse array of species and their habitats.

Climate change, with its wide-ranging impacts on temperature, precipitation patterns, and other environmental factors, can disrupt ecosystems and alter the distribution and abundance of species within the biosphere. These changes can have cascading effects on communities of organisms, populations of species, and the overall functioning of ecosystems. Therefore, the biosphere represents the highest level of organization that climate change can potentially impact.

Learn more about biosphere, here:

https://brainly.com/question/20531374

#SPJ5


Related Questions

Macroscopic urinalysis collects data on all EXCEPT which of the following?
A. turbidity
B. color
C. pH
D. odor

Answers

Answer:

The correct answer is - pH.

Explanation:

Macroscopic urinalysis is the evaluation of the physical appearance of the urine. It evaluates the amount, color, odor and clarity, and other physical appearances or characteristics.

It also checks if there are any clotting, or sediments are found in the sample. It does not include the pH of the urine in the microscopic urinalysis. It is recommended to check underlying medical conditions.

Question 2 of 10
What is the term for the condition of the atmosphere in a given area at a
given time?
A Weather
B. Latitude

C Climate
D. Altitude
SUBMIT
Need ASAP

Answers

A is the answer to this

Answer:

A .Weather

Explanation:

The state of atmosphere over an area at any point of time is known as weather. It is the state of the atmosphere over short periods of time. ... Precipitation, humidity, temperature, pressure, cloudiness, and wind are the basic atmospheric conditions that make up the weather of a region.

What could be inferred from suntans?

Group of answer choices

A tan might indicate sun damage to the skin.

Tanning produces healthier skin.

A tan strengthens the elastic in the skin.

Tanning makes skin look younger.

Answers

Answer:

A tan might indicate sun damage to the skin.

Explanation:

Tanning is the process by which the skin is exposed to the ultraviolet rays that comes from the sun with the purpose of producing a dark-brown coloration called a TAN.

A tan achieved by exposure to the sun can actually indicate that a person's skin is undergoing damage from the UV rays of the sun, hence, the skin responds by producing a protein called melanin, which protects the skin and later forms the dark coloration- tan. From this explanation, tan is got in response to a damaging signal received by the cell, hence, a tan might indicate sun damage to the skin.

Meiosis makes sperm and egg cells which are called

A. Gametes

B. Somatics

C. Spindles

Answers

Answer:

A. Gametes

hope it is helpful to you ☺️

the answer is gametes

Please help the picture is above I’ll mark as brainliest.

Answers

Answer: The last one im pretty sure.

Explanation:

CAN u pLZZ help me anwser my question

I’m 98% sure it’s c but it might be B could someone check pls

Answers

Answer:

I think C

Have a great day

[tex]#Liliflim✌[/tex]

Answer:

Explanation:

A

There are 20 different types of amino acids, which can result in a wide variety of protein shapes. Which of the following is not a function associated with proteins?
A. providing structure
B. speeding up chemical reactions as enzymes
C. information storage
D. all of these are functions of proteins​

Answers

Answer:

c information storage

Explanation:

information is stored in dna which provides the instructions required to make proteins . proteins do not store information

A cactus is adapted for life with limited water. The green
part of this cactus is its stem. Its stems are fleshy and
have a thick waxy coating.
What are two ways the structure of this cactus's stem helps the plant survive?
A. It takes in minerals from the soil.
B. It prevents water loss.
C. It carries out photosynthesis.
D. It holds the plant in the ground.

Answers

Answer:

i think its B hope it helps

Explanation:

Adaptations are the alteration that allows the survival of the fittest. The adapted structure of the cacti allows it to take the minerals from the soil and prevents water loss. Thus, options A and B are correct.

What are adaptations of cactus?

Adaptation is seen as the modified physical and chemical characteristics that allow the organism to survive in stressful conditions. A cactus has adapted spines, roots, waxy skin, and deep-layered stomata.

These adaptation has allowed the cactus to survive the harsh conditions of dessert. The wide fibrous roots allow it to draw nutrients and minerals from the soil.

The thick, expandable stem with deep-layered stomata prevents the loss of water from the surface in high-temperature conditions and keeps the plant hydrated.

Therefore, options A and B. the adapted attributes of cacti prevent water loss.

Learn more about adaptations here:

https://brainly.com/question/12501143

#SPJ5

pls help ASAP i will mark brainliest

Answers

Answer:

ok

i can help you ..............

Explanation:

drop in the air pressure objects small mammals and insects in many ways mice and mouse are good weather indicators people who spend a lot of time outdoor have obeserved that field mice come out there holes squeak and run around before a storms appearce.

mango tree and Vanda ecological interaction​

Answers

Answer:

The relation between a mango tree and an orchid is commensalism. An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are plants growing on other plants which, however, do not derive nutrition from them.

hope it helps

Conchoidal fracture in minerals creates a smooth _______________________ surface that is similar to the surface of a conch or seashell.

Answers

Conchoidal fracture in minerals creates a smooth, [tex]\sf\purple{curved}[/tex] surface that is similar to the surface of a conch or seashell.

[tex]\circ \: \: { \underline{ \boxed{ \sf{ \color{green}{Happy\:learning.}}}}}∘[/tex]

What is the source of the carbon dioxide that is used in photosynthesis?

Answers

Answer:

Photosynthetic cells

Explanation:

photosynthetic cells are diverse and are found in green plants during the process of photosynthesis cells use carbon dioxide and energy from the sun to make sugar molecules and make oxygen

What is the function of the class of macromolecules represented in the following diagram

Answers

Answer:

lods ayarn na:)

Explanation:

The four classes of biological macromolecules are (1) Proteins, (2) Lipids, (3) Carbohydrates, (4) Nucleic Acids.

Proteins are made up of amino acids linked by peptide bonds. They have multiple functions, depending on the number of amino acids and its specific sequence. They serve as major workers composing motor and structural elements in the cell. They can also function as catalytic proteins (enzymes), as well as helpers for storage, signal, transport, reception, defensive, and contractile tasks.

Lipids are made up of fatty acids (a carboxylic acid with a hydrocarbon chain + terminal carboxyl group) and glycerols (organic compound made up of multiple hydroxyl groups). They are a hydrophobic compound that are used for energy storage, thermal insulation, protection, and chemical messengers. Lipids also regulate membrane permeability and aid in fat soluble vitamin production.

Carbohydrates are made up of monosaccharides which build up a polysaccharide (carbohydrates). Monosaccharides are basic sugars which cannot be broken down anymore by water (glucose, fructose, galactose). Carbohydrates' major functions include energy provision, blood glucose regulation, biological processes recognition, and breakdown of fatty acids for ketosis prevention.

Nucleic acids are made up of nucleotides which are organic molecules that forms the Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA). Their structure consists of a nitrogenous base, pentose, and an attached phosphate group. The function of nucleic acids are the creation and storage of genetic information.

What type of RNA acts as a temporary copy of DNA's instructions and provides details on how to assemble a polypeptide
chain?

Answers

Answer:

messenger RNA (mRNA)

Explanation:

mRNA or messenger RNA is one of the three types of RNA molecules (the other being tRNA and rRNA) that is specifically responsible for carrying genetic information previously encoded and stored in the DNA into the ribosomes for translation to occur.

The process of translation results to the synthesis of amino acid sequences, which make up a polypeptide. Hence, it can be said that mRNA is that type of RNA that acts as a temporary copy of DNA's instructions and provides details on how to assemble a polypeptide chain.

natural selection selects ___________ less fit individuals .
natural selection selects ____________ viable individuals .

Answers

Answer:

viable

Explanation:

Only the animals who are able to survive will live long enough to reproduce

Question # 1: Which shape is CLOSEST to the truth for the shape of planet 1 point
Earth?
1. Which object best represents a true scale model
of the shape of Earth? (1) a table tennis ball
(2) a football (3) an egg (4) a pear
Option 1
Option 2
Option 3
Option 4

Answers

Answer:

(1) a table tennis ball

Explanation:

The earth will most closely resemble any type of sphere or circular ball.

What is a scavenger?
A) an organism that lives in or on another organism
B) an organism that feeds on dead matter
C) an organism that produces food from the energy in sunlight
D) organisms that eat plants and grasses

Answers

The correct answer is B) an organism that feeds on dead matter.

A scavenger is an organism that obtains its food by consuming dead or decaying organic matter.

These organisms play a crucial role in ecosystems by recycling nutrients and breaking down organic material that would otherwise accumulate.

Scavengers are often attracted to carcasses or decaying organic material, where they feed on the remains of dead plants or animals.

Scavengers can include a variety of organisms from different taxonomic groups, such as vultures, hyenas, flies, beetles, and certain species of bacteria and fungi. They have adaptations that allow them to consume and digest dead matter efficiently.

By consuming dead organic material, scavengers help in the decomposition process, returning nutrients to the ecosystem and maintaining ecological balance. They prevent the accumulation of dead matter, which can lead to the spread of diseases and the release of harmful substances.

In contrast to the other options, which describe different ecological roles or processes, option B accurately characterizes the feeding behavior and ecological role of scavengers in consuming dead matter as a source of nutrition.

Therefore, the correct answer is B.

For more such answers on scavenger

https://brainly.com/question/259333

#SPJ8

Para cada una de las historietas "la penicilina, Francisco Redi y Louis Pasteur" indiquen:
a) ¿Qué estudió el científico?
b) ¿Cuál fue el descubrimiento?
c) indica con que viñetas se relacionan cada paso del método científico, puedes subrayarla o transcribirla

Answers

Answer:

a)

Explanation:

je suis ask teacher

What two taxon make up the scientific name? Pick all that apply.
Kingdom
Phylum
Class
Order
Genus
Family
Species

Answers

Answer:

genus and species are combined to form a scientific name

Answer:

GenusSpecies

Explanation:

The word is genus and species. These two taxon make up the scientific name.

the tRNA for GUCAUCGAUCGAUCGGAUGCC

Answers

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

Which type of weather is associated with the eye of the hurricane?

calm

stormy

windy weather

Answers

Answer:

A windy weather

Explanation:

Tree will began to swayed

Because conservation means using fewer natural resources and reducing wastes, it helps
a.
slow overpopulation and grow food.
b.
prevent habitat destruction and reduce pollution.
c.
prevent biodiversity and destroy species.
d.
stop exotic species and create habitats.


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

a

Explanation:

just did it

Answer:

the answer should be "B"

hiii! ill give brainliest if u answer this :))

Why are enzymes important?

1. They contain the genetic material.

2. They speed up chemical reactions.

3. They bring water into the cell.

4. They help the cell maintain its shape.

Answers

They speed up chemical reactions

which two molecule do green plants use to make glucose

Answers

Answer:

Carbon Dioxide and Water

Starch is a polysaccharide used as a component of cell walls in plants.


True

False

Answers

Answer:

false

Explanation:

is type of carbohydrates

False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.

What are structural component of cell wall?

Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.

Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.

Learn more about cell wall, here:

https://brainly.com/question/965751

#SPJ2

Many functions in the body are controlled by
special compounds. Which statements about
these compounds do you think are true? Check
all that apply.
The body can make all of the compounds it
needs.
.
The body gets energy from some
compounds.
um
Some compounds determine physical
characteristics.

Answers

Answer:

Its either a or b

Explanation:

A say the body can make all of the compound its need

my suggestion compound are made up of water ,mineral protein carbs and fat

our body produce little nutrients so we need to eat to get the nutrients we need

im am going with b

B is the answer

two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad

Answers

Answer:

A. wheter the producers are located on land or in the water.


Which of the substances below are PRODUCTS of the overall chemical reaction of
photosynthesis?
A. ammonia
B. Unitrogen
C. carbon dioxide
D. water
oxygen
sugars

Answers

Answer:

essentially glucose and oxygen are the products of photosynthesis

Explanation:

PLEASE HELP WILL MARK BRANLIEST!
Fungi and bacteria are examples of _____:

A. decomposers, B. producers, C. consumers, D. demagorgans

Answers

Answer:

a. decomposers

Explanation:

Bacteria and fungi are best classified as decomposers. They decompose the bodies of dead plants and animals.



What is the
Magnification
of a plant cell?

Answers

Answer:

400x

Explanation:

Other Questions
hey shawty baes im so srry 4 asking sm but i have no clue what im doing A school painted 1/2 of a wall with 3 colors.Each color takes up the same amunt of space on the wall.What fraction of the wall does each color occupy? can someone help me please?! I'll give brainlest for correct answer Each question is worti 2 punts5. The Eiffel Tower, shown to the right, has a width of 328 feet and a height of 984 feet. Mariais designing a T-shirt for her trip to France and she wants to put a picture of the Eiffel tower onthe front of the shirt. The maximum space she can use on the shirt is a rectangle with a width of.75 feet and a height of 1.5 feet. Maria uses a scale factor of where k is an integer, to shrinkthe Eiffel Tower and fit it on the t-shirt. What is smallest possible value for k? Which words should be changed to make the sentence more appropriate for a general audience?called and cityutopian and monopolycitizens and knowledgeancient and forever Help plssss Im trying to finish this diagnostics test Why are most cars manufactured in China? PLEASE HELPP!!f(x) = 3x2 + 5x 2g(x) = 5x3 4x2 + 4Find (f +g)(2)O A. (f +g)(x) = 5x + 3x2 + x + 2B. (f +g)(x) = 8x3 + x + 2O c. (f +g)(x) = 523 2? + 5x + 2O D. (f +g)(x) = -52% + 7x2 + 5x 6 Give the name (monomial, binomial,trinomial, etc.) and the degree of thepolynomial.5x3 - x2 + 2 True or False: Soil gets its nutrients from earthworms and animal waste. *TrueFalse HELP. Been wasting points because of trolls.If another troll appears then I dont know npw maybe just end this sh t and I dont have friends too so I cant copy from anyone. What is Photosyntisis??..Good night sweet dreams...!! a child when he plays likes all the light he makes and he understands them all and with them a game begins.says the bush of smiles:-Hello dear baby!The flower says stop your steps!catch us say the butterfliesI'm smooth and small, call me a pebble.Sing the swallow againI've been calling you the puppy for a long time and he comes and play with me.the wind says run fastthe apple says I will bakeThx b. The following reaction takes place in a basic solution. (7 points)MnO4(aq) + NO2(aq) MnO2(s) + NO3(aq) The half-reactions (balanced only for atoms) are the following:MnO4 + 2H2O MnO2 + 4OHNO2 + 2OH NO3 + H2OUse the following steps to finish balancing the equation. i. Balance each half-reaction for charge. (2 points) ii. Multiply each half-reaction by the correct number in order to balance charges for the two half-reactions. (2 points) iii. Add the equations and simplify to get a balanced equation. (2 points) iv. How can you tell from this equation that the reaction occurred in a basic solution? (1 point) A car starts from rest and acquires a velocity of 72 km/h in 5s. Find the distance travelled by car assume motion of car is uniform. The sixth graders at Kingston Middle School voted for their favorite sport. The results are in the circle graph below. Favorite sports 3/20 Football 1/2 Basketball 1/2 Golf Baseball 1/10 If the 180 students in sixth grade get to choose a sport to play for a special reward, how many of these students will choose basketball? Which statement about Genghis Khan is true? He was killed in battle while fighting the forces of the Song dynasty. He constructed the important east-west trade artery known as the Silk Road. He united the Mongol tribes and became known as the "ruler of all men." He was the first emperor of China who began construction of the Great Wall. If 0.3250 L of 0.125 M NaOH base were used in a titration, what were the moles of base? You buy items costing $1900 and finance the cost with a fixed installment loan for 24 months at 8% simple interest per year. 1. What is the finance charge? 2. What is your monthly payment? * Please explain how you got the answer* Solve the following equation for x: 2x 3y = 6.Ox = y + 3Ox=y-332Ox= -2y-32Ox= -x + 3