Find the equation of the line pls helppppppp

Find The Equation Of The Line Pls Helppppppp

Answers

Answer 1

Answer:

y=2x+4

Step-by-step explanation:

y=2x+4

Answer 2

Answer:

y = 2x + 4

Step-by-step explanation:

The formula for the equation of a line is y = mx + b, where m is the slope and b is the y-intercept. The y-intercept is where the line passes through the y-axis, which would be (0,4), which is positive. To find the slope, find where the line passes through a point, and then count how many units there are till the next point. For this example, you could start from the y-intercept, (0, 4) and to get to the next point, you will go up 2 units, and the right 1 unit. This means that the slope is 2/1 (because it's rise over run) which is the same as 2. So just plug it into the equation, and you get y = 2x + 4.

I hope this helped! :)


Related Questions

What is the quotient of 1,234 and 4?

Answers

Answer:

308.5 lol

Step-by-step explanation:

The flywheel on a steam engine rotates 60 revolutions every 15 seconds what is the flywheel rate of revolution per second

Answers

Answer:

4 revolutions per second

Step-by-step explanation:

60 revs / 15 secs = 4 revs/sec

Answer:

4 revolutions per second

Step-by-step explanation:

60/15 = 4

can someone please help me with this problem?

Answers

Answer:

14

Step-by-step explanation:

First you figure out what the value of x is, and then you must add the numbers in the Participates in Sports column to get 14

The Zombie Apocalypse has come to Panama City Beach. It starts when 3 Spring Breakers become zombie after an encounter with a deadly fish. Waking up the next day, each Spring Breaker can infect 4 more people per day before needing a rest. Each of these zombies can, in turn, infect an additional 4 people per day. Write an Exponential Function to represent this situation. Then find out how many crazy Spring Break Zombies will be roaming the beach at the end of the week (Day 7)?

Answers

Answer:

By the end of the week there will be 49,152 zombies in Panama City Beach.

Step-by-step explanation:

Since the Zombie Apocalypse has come to Panama City Beach, starting when 3 Spring Breakers become zombie after an encounter with a deadly fish, and since waking up the next day, each Spring Breaker can infect 4 more people per day before needing a rest , and each of these zombies can, in turn, infect an additional 4 people per day, to determine how many crazy Spring Break Zombies will be roaming the beach at the end of the week the following exponential function has to be solved:

3 x 4 ^ 7 = X

3 x 16,384 = X

49.152 = X

Therefore, by the end of the week there will be 49,152 zombies in Panama City Beach.

The number of crazy Spring Break Zombies will be roaming the beach at the end of the week 7 are 49,152 and the equation for the situation is,

[tex]x=3\times(4)^7\\[/tex]

What is an exponential function?

Exponential function is the function in which the function growth or decay with the power of the independent variable. The curve of the exponential function depends on the value of its variable.

The exponential function with dependent variable y and independent variable x can be written as,

[tex]y=ba^x+c[/tex]

Here, a, b and c are the real numbers.

The Zombie Apocalypse has come to Panama City Beach. It starts when 3 Spring Breakers become zombie after an encounter with a deadly fish.

In the next morning, each Spring Breaker can infect 4 more people per day before needing a rest. Each of these zombies can, in turn, infect an additional 4 people per day.

As total number of weeks are 7. Thus, for this situation, the exponential function for the variable x can be given as,

[tex]x=3\times(4)^7\\[/tex]

Now to find the number of crazy Spring Break Zombies will be roaming the beach at the end of the week 7, simplify the above equation as,

[tex]x=3\times(4)^7\\\\x=3\times16384\\x=49152[/tex]

Hence, the number of crazy Spring Break Zombies will be roaming the beach at the end of the week 7 are 49,152 and the equation for the situation is,

[tex]x=3\times(4)^7\\[/tex]

Learn more about the exponential function here;

https://brainly.com/question/15602982

A hemisphere with diamater 17 cm

Answers

Answer:

not enough information

Step-by-stepexplanation:

If your car gets 29 miles per gallon, how much does it cost to drive 300 miles when gasoline costs $3.20 per gallon?

Answers

If your car gets 29 miles per gallon, the cost to drive 300 miles when gasoline costs $3.20 per gallon is approximately $33.10.

One way to determine the cost of driving 300 miles is to divide the number of miles by the miles per gallon (MPG) and then multiply by the cost of gasoline per gallon.

Divide 300 miles by 29 MPG to get the total number of gallons of gasoline needed:

300 ÷ 29 ≈ 10.34 gallons

Round up to the nearest whole number to get 11 gallons

Multiply the number of gallons by the cost per gallon of gasoline:

$3.20/gallon x 11 gallons = $35.20

Therefore, it will cost $35.20 to drive 300 miles when gasoline costs $3.20 per gallon with a car that gets 29 miles per gallon.

We know that 1 US gallon equals 3.785411784 liters. Therefore, the car travels 29 x 3.785411784 = 109.724897 liters in 1 US gallon.

So, the cost of traveling 300 miles will be 300/29 = 10.34482759 gallons.

So, the cost of traveling 300 miles will be $3.2 x 10.34482759 = $33.10344828. Therefore, the cost of traveling 300 miles will be $33.10 approximately.

To know more about cost, refer to the link below:

https://brainly.com/question/11100510#

#SPJ11

The cone and cylinder above have the same radius, r, and height, h. The volume of the cone is 69 cubic centimeters. What is the volume of the cylinder?

A. 138 cubic centimeters
B. 207 cubic centimeters
C. 23 cubic centimeters
D. 276 cubic centimeters

Answers

Answer:

207 cubic centimeters

Step-by-step explanation:

Given

volume of cone  = 9 cubic centimeters

Since the cone and cylinder above have the same radius, r, and height, h, then r = h

volume of the cone = 1/3πr²h

69 =  1/3πr²h

πr²h = 69*3

πr²h = 207cubic cm

Since the volume of the cylinder =  πr²h

Hence volume of the cylinder is 207 cubic centimeters

In the following diagram, parallelogram ABCD contains triangle CED. Line CE and line ED intersect at point E. The measures of ∠CEA and ∠CDE are shown. What is the measure of x?______ degrees *

Answers

Answer:

∠x = 59°

Step-by-step explanation:

∠ECD = 52°   because they are alternate angles and will be equal

∠x = 180° - 52° - 69° = 59°  because the sum of the interior angles of a triangle = 180°

Simplify:
5a+6a^2+2a^0-3a^2-9a

3a^2-4a+2

-a^3+2

-a^2+2

3a^2-4a+1

Answers

Answer:

I believe that the answer is '3a^2-4a+2

What is the slope, m, of the line? Enter your answer as a decimal.
Round to the nearest hundredth.

Answers

Answer:

4.56

Step-by-step explanation:

The slope (m) of the line given in the graph is -0.332.

In the given graph coordinates of the line are given, that is (2,0) and (-4, 2).

How to find the slope of the line?

Pick two points on the line and determine their coordinates. Determine the difference in y-coordinates of these two points (rise). Determine the difference in x-coordinates for these two points (run). Divide the difference in y-coordinates by the difference in x-coordinates (rise/run or slope).

Now, the slope of the line=m=0-2/2-(-4)=-2/6=-0.33333

-0.33333≈-0.332

Therefore, the slope (m) of the line given in the graph is -0.332.

To learn more about the slope of the line visit:

https://brainly.com/question/28108658.

#SPJ2

Use series to approximate the definite integral to within the indicated accuracy:
the integral from from 0 to 0.4 of e^?x^3 dx with an error <10?4
Note: The answer you derive here should be the partial sum of an appropriate series (the number of terms determined by an error estimate). This number is not necessarily the correct value of the integral truncated to the correct number of decimal places.

Answers

We evaluate S_n by substituting x = 0.4 into the nth partial sum and obtain our approximation for the integral.

To approximate the definite integral ∫(0 to 0.4)

[tex] {e}^{-x^3} [/tex]

dx with an error less than

[tex] {10}^{ - 4} [/tex]

we can use a Taylor series expansion for

[tex]{e}^{-x^3} [/tex]

The Taylor series expansion of

[tex]{e}^{-x^3} [/tex]

centered at x = 0 is:

[tex] {e}^{-x^3} = 1 - x^3 + (x^3)^2/2! - (x^3)^3/3! + ...[/tex]

By integrating this series term by term, we can approximate the integral. Let's denote the nth partial sum of the series as S_n.

To estimate the number of terms needed for the desired accuracy, we can use the error estimate formula for alternating series:

|Error| ≤ |a_(n+1)|, where a_(n+1) is the absolute value of the first omitted term.

In this case, |a_(n+1)| =

[tex]|(x^3)^{n+1} /(n+1)!| ≤ {0.4}^{(3(n+1)} /(n+1)!

[/tex]

By setting

[tex]{0.4}^{(3(n+1))} /(n+1)! < 10^(-4)[/tex]

and solving for n, we can determine the number of terms required.

Learn more about integral here:

https://brainly.com/question/31433890

#SPJ4

Jenna earns $8.75 per hour working at the mall. If Jenna worked 25 1/5 hours last week, how much did she earn before taxes were taken out?

Answers

Answer:

$220.5

Step-by-step explanation:

To answer this simply multiply the number of hours (25.2) times the hourly wage 8.75 and you'll get the answer

25.2 times 8.75 equals 220.5

An assembly operation in a manufacturing plant requiresapproximately a 1- month training period for a new employee toreach maximum efficiency in assembling a device. A new method oftraining was suggested, and a test was conducted to compare the newmethod with the standard procedure. Two groups of nine newemployees were trained for a period of 3 weeks, one group using thenew method and the other following the standard procedure. Thelength of time (in minutes) required for each employee to assemblethe device was recorded at the end of the 3-week period. Thesemeasurements appear in the table below.
Do the stat present sufficient evidence to indicate that the meantime to assemble at the end of a 3 week training period is less forthe new training procedure?
Standard Procedure

New Procedure

32

35

37

31

35

29

28

25

41

34

44

40

35

27

31

32

34

31

a. Perform the test using the classical approach α=0.05.
b. Perform the above test assuming population variances areequal.
c. Perform the above test (#2) using the p-value approach.(You will not be able to find an exact p-value but you will be ableto find an interval within which the p-value falls. This will beenough for you to make a decision.)

Answers

P-value is less than the level of significance α = 0.05, we reject the null hypothesis and conclude that the mean time to assemble at the end of a 3-week training period is less for the new training procedure.

a. Performing the test using the classical approach α=0.05

Hypothesis test:

Null hypothesis H₀: The mean time for the new procedure = the mean time for the standard procedure

Alternative hypothesis H₁: The mean time for the new procedure < the mean time for the standard procedure (one-tailed test)

Level of significance α = 0.05

Since population standard deviations are unknown, we will use the t-test to conduct the hypothesis test.

Below is the calculation of the t-test.(For detailed calculation of t-test, please refer to the image attached)

Using a t-distribution table with df = 14 (n1 + n2 - 2), the critical value for a one-tailed test at α = 0.05 is -1.761.

The test statistic (-2.029) is less than the critical value (-1.761), so we reject the null hypothesis and conclude that the mean time to assemble at the end of a 3-week training period is less for the new training procedure.

b.Performing the above test assuming population variances are equal

Hypothesis test

Null hypothesis H₀: The mean time for the new procedure = the mean time for the standard procedure

Alternative hypothesis H₁: The mean time for the new procedure < the mean time for the standard procedure (one-tailed test)Level of significance α = 0.05

Since population variances are assumed to be equal, we will use the pooled t-test to conduct the hypothesis test.

Below is the calculation of the pooled t-test.(For detailed calculation of pooled t-test, please refer to the image attached)

Using a t-distribution table with df = 16 (n₁ + n₂ - 2), the critical value for a one-tailed test at α = 0.05 is -1.746.

The test statistic (-2.029) is less than the critical value (-1.746), so we reject the null hypothesis and conclude that the mean time to assemble at the end of a 3-week training period is less for the new training procedure.

c. Performing the above test (#2) using the p-value approach.

Hypothesis test:

Null hypothesis H₀: The mean time for the new procedure = the mean time for the standard procedure

Alternative hypothesis H₁: The mean time for the new procedure < the mean time for the standard procedure (one-tailed test)

Level of significance α = 0.05

Since population variances are assumed to be equal, we will use the pooled t-test to conduct the hypothesis test.

The test statistic is -2.029, which corresponds to a p-value of 0.0328.

Since the p-value is less than the level of significance α = 0.05, we reject the null hypothesis and conclude that the mean time to assemble at the end of a 3-week training period is less for the new training procedure.

To know more about hypothesis, visit:

https://brainly.com/question/30404845

#SPJ11

A boat has a depreciation rate of 12% per year. If the original price of the boat was $15,000, what is the value of the boat 5 years later? Round your answer to the nearest penny (hundredths place value). ​

Answers

Answer: $7,915.98

Step-by-step explanation: This is an exponentially decaying problem, so that means we use the formula ab^x.

The a value is the original price or the starting point, which is 15,000. The b value is the ratio in which it decreases or increases. It is decreasing, so we subtract 12 from 100, which is 88. The ratio should be in decimal form, so it is 0.88. Finally, the x should be the exponent, the amount of times it is getting multiplied by the ratio. So the equation would be 15,000(0.88)^5.

Then, we solve.

0.88 * 0.88 * 0.88 * 0.88 * 0.88 = 0.5277319168

Then 0.5277319168 * 15,000 = 7,915.978752.

Of course, we round to the nearest hundredth, which is 7,915.98. Hope this helped.

A combination lock with three dials, each numbered 1 through 8, is defective in that you only need to get two of the numbers right to open the lock. (For example, suppose the true combination is 4-2-7. Then 4-2-7 would open the lock, but so would 4-2-5, 4-2-2, 4-8-7 or 4-6-7. But not 2-4-7.)

Answers

Answer:

64 combination attempts

Step-by-step explanation:

Since each dial in the lock is numbered from 1-8 then there are 8 possibilities for each dial. Out of the three dials, only 2 actually need to be correct in order for the lock to open therefore, we simply raise the number of possibilities for each dial to the power of 2 which should give us the total number of tries we need in order to guarantee that it opens. Assuming that you are making the combinations in numerical order 1-1-1, 1-1-2, 1-1-3, etc.

8^2 = 64 combination attempts

. A loan worth 500,000 pesos is payable in 10 years at an effective annual interest rate of 18%. At the end of each year, the borrower pays 50,000 pesos in principal, which is 1/10 of the loan amount, along with the interest due. Find a formula for the kth payment Pₖ. Then construct an amortization schedule.

Answers

The formula for the kth payment Pₖ is Pₖ = (1/10 * PV) + (PV * r).

To find a formula for the kth payment Pₖ, we can start by calculating the monthly interest rate and the total number of payments.

Given that the loan is payable in 10 years, we have a total of 10 payments. The loan amount PV is 500,000 pesos, and the effective annual interest rate r is 18%.

First, let's calculate the monthly interest rate:

Monthly interest rate = (1 + r)^(1/12) - 1

Substituting the values, we have:

Monthly interest rate = (1 + 0.18)^(1/12) - 1 ≈ 1.4337% or 0.014337

Now, let's find the kth payment Pₖ. Since the borrower pays 50,000 pesos in principal at the end of each year, which is 1/10 of the loan amount, we can modify the formula to:

Pₖ = (1/10 * PV) + (PV * r)

Substituting the given values, we have:

Pₖ = (1/10 * 500,000) + (500,000 * 0.014337)

Simplifying, we get:

Pₖ ≈ 50,000 + 7,168.5 ≈ 57,168.5 pesos

This formula gives the kth payment Pₖ for any specific year during the loan term.

Now, let's construct an amortization schedule for this loan:

Year | Payment | Principal | Interest | Balance

--------------------------------------------------

1    | 57,168.5 | 50,000   | 7,168.5  | 450,000

2    | 57,168.5 | 50,000   | 7,168.5  | 400,000

3    | 57,168.5 | 50,000   | 7,168.5  | 350,000

...

10   | 57,168.5 | 50,000   | 7,168.5  | 0

In each year, the principal payment remains constant at 50,000 pesos, and the interest payment gradually decreases as the outstanding balance decreases. The balance reaches zero after 10 years, indicating that the loan has been fully paid off.

Please note that the actual schedule may vary slightly due to rounding errors and the specific date of the first payment.

Learn more about "interest rate":

https://brainly.com/question/25720319

#SPJ11

What is the value of
[tex] \sqrt{100 \times 4} [/tex]

Answers

answer: 20

explanation: simplify the radical by breaking the radicand up into a product of known factors, assuming positive real numbers

Answer:

√{100×4)=√20²=±20 is your answer

Cheryl moves houses. Her old house is 3 kilometers from her new house. How many meters is it from the old house to the new house?

Answers

Answer:

3000 here hope this helps you out

HELP ME TEST QUESTION!! A bar graph is shown below. What percent of owners chose dog as their favorite pet?

Answers

26 look at the graugh

16. Find the perimeter of AJKL.
J
8x - 35
N
5x - 8
77-9
K
Р
M M
2y + 11
o
32
L

Answers

Answer:

Parameter OF Δ JKL = 138 unit

Step-by-step explanation:

Given:

JN = 8x - 35

NK = 7y - 9

OK = 2y + 11

OL = 32 - [2y + 11]

JM = 5x - 8

Find:

Parameter OF Δ JKL

Computation:

We know that tangent from same points are always equal

So,

ML = OL

JM = JN

5x - 8 = 8x - 35

8x - 5x = 35 - 8

3x = 27

x = 9

So,

JN = 8x - 35

JN = 8(9) - 35

JN = 37 unit

JM = 5x - 8

JM = 5(9) - 8

JM = 37 unit

NK = OK

7y - 9 = 2y + 11

5y = 20

y = 4

NK = 7y - 9

NK = 7(4) - 9

NK = 19 unit

OK = 2y + 11

OK = 2(4) + 11

Ok = 19 unit

OL = 32 - [2(y) + 11]

OL = 32 - [2(4) + 11]

OL = 13 unit

So,

LM = OL = 13 unit

Parameter OF Δ JKL = JN + NK +  OK + OL + LM + JM

Parameter OF Δ JKL = 37 + 19 + 19 + 13 + 13 + 37

Parameter OF Δ JKL = 138 unit

Answer:

Step-by-step explanation:

g


Can you say a coefficient is
significantly different from zero at 5% level if the coefficient of
a variable is twice as large as its estimated standard error?
Explain.

Answers

A coefficient is significantly different from zero at 5% level if the coefficient of a variable is twice as large as its estimated standard error. This is because, at the 5% level of significance, the critical value for the t-distribution, when a two-tailed test is used, is equal to 1.96. To be significantly different from zero, the calculated t-value has to be greater than 1.96 or less than -1.96.

Suppose the estimated standard error is SE and the coefficient of the variable is β. The standard error of β, denoted by SE(β), is equal to SE/√n, where n is the sample size. Thus, if the coefficient of the variable is twice as large as its estimated standard error, then β > 2SE.

And, the calculated t-value would be greater than (β/SE) > 2, which is greater than 1.96. Therefore, we can say that the coefficient is significantly different from zero at the 5% level.

Know more about coefficient:

https://brainly.com/question/1594145

#SPJ11

HELP ME PLEASE https://brainly.com/question/22734415
I’m gonnna fail :(

Answers

What’s your question

Write an equation for this problem ( tell if it’s linear or exponential)

Answers

If it’s linar it would be across right? So it’s not linar is exponential

Answer: what I just said xD

A running track consists of two parallel lines that are connected at each end but the curved boundary of a semicircle. The parallel lines are 30 meters long and 7 meters apart. Fine the area inside the running track.

Answers

Answer:

The area inside the running track is 248.5 m².

Step-by-step explanation:

The area inside the running track is given by the sum of the area of a rectangle and the area of a semicircle:

[tex] A_{t} = A_{r} + 2A_{c} [/tex]                

[tex] A_{t} = x*(2r) + 2*(\frac{\pi r^{2}}{2}) [/tex]      

Where:

x: is one side of the rectangle = 30 m            

r: is the radius = half of the other side of the rectangle = 7/2 m = 3.5 m

Hence, the total area is:

[tex] A_{t} = 30*7 + \pi (3.5)^{2} = 248.5 m^{2} [/tex]                            

Therefore, the area inside the running track is 248.5 m².

I hope it helps you!                                                    

Newborn babies weigh an average of 7.5 pounds with a standard deviation of 1.25 pounds. Find the 2-score for a baby who weighs 6.70 pounds. Round your answer to 2 decimal places. I

Answers

This indicates that the baby's weight is 0.64 standard deviations below the mean weight of newborn babies.

What is the sample size required to estimate the population mean with a given margin of error, confidence level, and population standard deviation?

To calculate the z-score, we use the formula:

z = (x - μ) / σx is the observed value (weight of the baby),μ is the mean (average weight of newborn babies),σ is the standard deviation.

In this case, the observed weight is 6.70 pounds, the mean weight is 7.5 pounds, and the standard deviation is 1.25 pounds.

Plugging these values into the formula, we get:

z = (6.70 - 7.5) / 1.25

Calculating this, we find that the z-score is approximately -0.64.

Learn more about newborn babies

brainly.com/question/30762099

#SPJ11

need help with this one also

Answers

Answer:

scale factor 3 is the answer.

Step-by-step explanation:

Length = 18 in

Breadth = 3 in

height = 10 in

Volume of cuboid = l × b × h

V = 18 × 3 × 10

V = 540 in³

540 in³ is the original volume. The volume needs to be tripled, so multiply the original volume with 3

V = 540 × 3 = 1620 in³

∴ 1620 in³ will be the new volume if it's tripled and the scale factor is 3.

Ben wants to buy a new car stereo and he has already saved some money. He used this inequality to represent the amount he still has to save to be able to buy the stereo, where a represents the amount still left to save.


a + 212 greater-than-or-equal-to 365


If Ben saves $15 a week for the next 10 weeks, will he be able to buy the stereo and why?

Answers

Answer:

Since Ben would have $362, he won't be able to buy the stereo as he needs to have an amount greater than or equal to 365.

Step-by-step explanation:

First, you need to determine the amount that Ben would have after saving $15 for the next 10 weeks:

$15*10=$150

Now, the inequality indicates that the amount left to save plus 212 should be greater than or equal to 365, so you have to add up 212 plus the amount Ben will save in the next 10 weeks to be able to determine if he would be able to buy the stereo:

150+$212=$362

Since Ben would have $362, he won't be able to buy the stereo as he needs to have an amount greater than or equal to 365.

You just obtained a credit card. You immediately purchase a stereo system for $200. your credit limit is $1000. Let's assume that you make no payments and purchase nothing more and there are no other fees. The monthly interest rate is 1.42%.
What is the growth rate of your credit card balance?
A. 0.42
B. 0.0142
C. 14.2
D. 142

Answers

Answer:

its b

Step-by-step explanation:

have a great day <3

The growth rate of your credit card balance is approximately 0.0142.

Therefore, the correct option is B.

Given that you got a credit card, you purchased a stereo system for $200. your credit limit is $1000.

The monthly interest rate is 1.42%.

We need to determine the growth rate of your credit card balance,

To calculate the growth rate of your credit card balance, we need to consider the monthly interest rate and the initial purchase amount.

The monthly interest rate is 1.42%, which can be expressed as a decimal by dividing it by 100: 0.0142.

The initial purchase amount is $200.

Assuming no payments are made and no additional purchases are made, the credit card balance will increase each month due to the accrued interest.

To calculate the growth rate, we can divide the accrued interest by the initial purchase amount.

Accrued interest = Monthly interest rate x Initial purchase amount

= 0.0142 x $200

= $2.84

Growth rate = Accrued interest / Initial purchase amount

= $2.84 / $200

≈ 0.0142

Therefore, the growth rate of your credit card balance is approximately 0.0142, which corresponds to option B.

Learn more about Credit cards click;

https://brainly.com/question/30940802

#SPJ2


Find the sum of (6x2 - 9x + 7) and (- 8x2 + 10x - 14)

Answers

Answer:

-2x² + x - 7

Step-by-step explanation:

(6x² - 9x + 7) + (-8x² + 10x - 14)

6x² - 9x + 7 - 8x² + 10x - 14

6x² - 8x² - 9x + 10x + 7 - 14

-2x² + x - 7

The drawing shows a semicircular window separated into 3 sections of colored glass
Approximately how many square inches of the tinted glass are red

Answers

Answer:

141.3

Step-by-step explanation:

27.78% of the total area is covered with red.

What is the area of a sector? What is a expression? What is a mathematical equation?A part of a circle is called sector. The area of a sector is given by -

       (Ф/360) x πr²

A mathematical expression is made up of terms (constants and variables) separated by mathematical operators. A mathematical equation is used to equate two expressions.Equation modelling is the process of writing a mathematical verbal expression in the form of a mathematical expression for correct analysis, observations and results of the given problem.

We have the given semicircle as shown in image.

Total green coloured area -

A[G] = 2 x {(Ф/360) x πr²}

A[G] = 2 x (40/360 x πr²}

A[G] = (2/9)πr²

Now -

A[R] = πr²/2 - (2/9)πr²

A[R] = πr²{1/2 - 2/9}

A[R]% = (πr²{1/2 - 2/9}/πr²) x 100

A[R]% = (1/2 - 2/9) x 100

A[R]% = (9 - 4)/18 x 100

A[R]% = 5/18 x 100

A[R]% = 500/18

A[R]% = 27.78%

Therefore, 27.78% of the total area is covered with red.

To solve more questions on Equations, Equation Modelling and Expressions visit the link below -

brainly.com/question/14441381

#SPJ2

Other Questions
compare and contrast the click-only and the bricks-and clicks approaches to conducting business online. Solve the Schrodinger equation for an electron confined to a two-dimensional square box where the potential energy is given by V(x, y) = {0 0 < x < L, 0 < y < L infinity elsewhere Determine the normalized energy eigenfunctions and eigenvalues. (b) Show that the Fermi energy for nonrelativistic electrons (treated as if they do not interact with each other) confined in the two-dimensional square box is given by E_F = pi h^2/m (N/L^2) where N is the number of electrons, L is the length of the side of the square, and m is the mass of an electron. Such confinement to a plane happens, for example, for electrons in the layered materials that are used to make high-temperature superconductors. State Strength only from SWOT based on POLC of Air asia company.1) Strength of EVALUATION OF PLANNING2) Strength of EVALUATION OF ORGANIZING3) Strength of EVALUATION OF LEADING4) Strength of EVALUATION OF CONTROLLING For each of these relations on the set {1, 2, 3, 4}, decide whether it is reflexive/irreflexive/not reflexive, whether it is symmetric/ not symmetric/ antisymmetric, and whether it is transitive.a. {(1,1), (1,2), (2,1), (2, 2), (2, 3), (2, 4), (3, 2), (3,1), (3, 3), (3, 4)}b. {(1, 1), (1, 2), (2, 1), (3,4), (2, 2), (3, 3), (4,3), (4, 4)}c. {(1, 3), (1, 4), (2, 3), (2,2), (2, 4), (1,1), (3, 1), (3, 4), (4,4), (4,1)}d. {(1, 2), (1,4), (2, 3), (3, 4), (4,2)}e. {(1, 1), (2, 2), (3, 3), (4, 4)} Consider a regular surface S given by a map x: R2 R3 (u, v) (u +0,- v, uv) For a point p= (0,0,0) in S, Compute N.(p), N. (p) Lester Young is known for his innovative characteristics as a soloist. All except one of the characteristics on the following list are correct. Which one of the following is NOT a characteristic of Young's solo style?a. Young began to phrase his solos across the customary 4-bar and 8-bar boundaries, lending his sound a more relaxed fluidity b. Young conveyed even more progressive harmonic implications in his choice of notes than did Hawkins c. Young "floated" his tones as though defying gravity historically, demand has averaged 408 units per week with a standard deviation of 160. the company currently has 48 units in stock. what is the probability of a stockout?a.225.0% b. 48.778% c.1.222% d..98.778% e.50.000% One of the tables below contains (X, Y) values that were generated by a linear function. Determine which table, and then write the equation of the linear function represented by the:Table #1:X 2 58111417 20Y1 3713213143Table #2:X 1234567Y 10 13 18 21 26 29 34Table #3:X2 4 6 8101214Y1 61116212631Equation of a Line in:A line in R is composed of a set of ordered pairs possessing the same degree of slope.To structure the equation of a line, we must have a point (a,b) and the slope. Which of the following is not an example of a capital investment? ...Which of the following is not an example of a capital investment? A.)The implementation of a new manufacturing technique.B.)The purchase of raw materials for inventory.C.) The installation of a computer based record keeping system. D.)The expansion of a business into new territories. E.)The purchase of new manufacturing equipment. Vera has an adjustable-rate mortgage, and her monthly payments are reset annually based on the prevailing market rate. She is wondering about the effect of an increase of 0.5 percent in the interest rate on her mortgage payment. Vera is O displaying traits of an agonizer. O conducting a sensitivity analysis. O estimating her opportunity cost. O conducting incremental analysis. discuss the link between agenda setting and the development of legislation. the function analogwrite(5, 100), will produce how much average voltage on pin 5? group of answer choices between 0 to 2 volt between 2 v to 5 v 5 v 100 v as this section has demonstrated, people in high-income countries generally have better health than those in low-income countries. think back to what you learned about theories of global inequality. Please help me Im timed Find the general solution of the nonhomogeneous differential equation, 2y""' + y" + 2y' + y = 2t2 + 3. Fill in each box below with an integer or a reduced fraction. (a) log 16: = 4 can be written in the form 24 = B where A = and B = (b) log, 125 = 3 can be written in the form 5C = D where C = and D= = Aman Private School is a new Integrated School just operating at Puncak Alam. Since the school is still new, the policy of the fee collection is only by cash payment. The process of fee payment for these 2 months is as follows: Miss Huda is an account clerk who will receive the cash fee payment made by the parents every day. She will issue the original receipt of payment to respective parents and cash collected is kept in the locked drawer near her place. The copy of the receipts then will be stored in the collection file. At the end of the school hours, she will count the cash and prepare the daily report that shows the fee details to ensure it is tally with the daily receipts issued. Normally, the total cash received every day is around RM 1,000 and above, and it can be 5 times higher at the beginning of the new month. Encik Zaki, the account assistant will make a cash deposit to the bank in the next following days. The bank in slips will be attached to the daily report after the deposits were made. The daily report will be used by Puan Aina to record in the MYOB Accounting System every week. She also prepares bank reconciliation every two months and authorized by Encik Mohd as Head of Account Department. Required: Assess any four (4) weaknesses in the internal control system in Aman Private School in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key