Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer 1

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.


Related Questions

Which of these would be an example of cultural bias in profiling?

a) Investigators are sure that their suspect is a tall male because they have found large footprints in the mud.
b) Investigators conclude that the victim allowed the suspect to enter the home, so they knew each other.
C) Investigators say that the suspect must be of a certain minority because that is who usually commits the crime in their precinct.
d) Investigators look for all the people leaving the crime scene to see if they are possible suspects.

Answers

Answer:

C) Investigators say that the suspect must be of a certain minority because that is who usually commits the crime in their precinct.

Explanation:

Cultural bias is the action where by someone holds a bias about a particular group of people or ethnicity due to the negative information which he or she had been feed with while growing up.

For example, when someone believes that, all crimes committed in America is done by African American people is a typical example of cultural bias. In the scenario given above, for the investigator to believe that, the suspect to be a certain minority rather than having an open view that it could have been anyone shows cultural bias and profiling of the investigators.

answer the question and ill give brainliest show your work and proof too

Answers

ANSWER:

asia

explantion

How does natural selection affect populations?

Answers

Answer:

Over time, these advantageous traits become more common in the population. Through this process of natural selection, favorable traits are transmitted through generations. Natural selection can lead to speciation, where one species gives rise to a new and distinctly different species.

Explanation:

which of the following is the best way to dispose waste water.​

Answers

try posting the question again because you forgot to include the options.

post the answer choices

Which is NOT a similar function of all cells?
photosynthesis
reproduction
absorption of nutrients
growth

Answers

Answer:

A is the answer hope it helps

What was the order of steps taken by the United States to clean the air?

enact the Clean Air Act, establish funding to study how to clean the air, create the EPA, and find cost-effective ways to keep the air clean
establish funding to study how to clean the air, enact the Clean Air Act, create the EPA, and find cost-effective ways to keep the air clean
find cost-effective ways to keep the air clean, establish funding to study how to clean the air, create the EPA, and enact the Clean Air Act
create the EPA, enact the Clean Air Act, find cost-effective ways to keep the air clean, and establish funding to study how to clean the air

Answers

The us started the process with finding cost effective options

Answer:

A

Explanation

The United States took first steps to keep the air clean.

Cost-effective ways to reduce pollution were emphasized.

The United States created the environmental protection agency.

Modifications and improvements were made to the Clean Air Act.

Funding was established under the Clean Air Act to study air pollution

1. What do you understand by the resolution or resolving power of a lens?​

Answers

Answer:

The resolving power of an objective lens is measured by its ability to differentiate two lines or points in an object. The greater the resolving power, the smaller the minimum distance between two lines or points that can still be distinguished. The larger the N.A., the higher the resolving power.

Explanation:

HURRY
Which combination of sex chromosomes results in a male human being? *
1 point
XX
YY
XY
either XX or YY

Answers

Answer: it's XY

Explanation:

What is the environmental change shown in the image?
Lack of food and water
Reduced space
Pollution

Answers

Answer:

Lack of food and water

Explanation:

The answer is lack of food and water

During replication which sequence of nucleotides would bond with DNA sequence TATGA?

Answers

Answer:

ATACT

Explanation:

I hope this helps.

Which statement best describes a difference between a molecule of DNA and a molecule of RNA?
A)DNA contains genetic informationwhile RNA does not
B)RNA contains the letter in place of the letter T in DNA
C)DNA has 1 strand, while RNA has 2
D)RNA uses the letter C. while DNA does not

Answers

Answer: B

Explanation:

Which one of the following statements is not true? Enzymes,

A) are typically consumed by the reactions they promote

B) are proteins that change the rate of chemical reactions.

C) have structures that correspond to their function.

D) function as organic catalysts.

E) regulate virtually all chemical reactions in a cell.

Answers

Answer:

statement c

Explanation:

d and c are very different so it would be those two but function is organic so its c

Puzzle #4 four digit code

Answers

Answer:

Im doing this but I was honestly looking for a cheat sheet lol

PLEASE HELP !! ILL GIVE BRAINLIEST *EXTRA 40 POINTS* DONT SKIP :(( .!

Answers

A or D hope i helped

Match the body cavity type to its proper description. - Coelomate - Pseudocoelomate - Acoelomate - Coelom A. A fluid or air-filled space between the digestive tract and the outer body wall. B. Completely lacks a body cavity between the digestive cavity and outer body wall. C. Has a body cavity lined by tissue derived from the mesoderm and by tissue derived from the endoderm. D. Has a body cavity completely lined by tissue from the mesoderm. E. Germ Layer

Answers

Answer: A. A fluid or air-filled space between the digestive tract and the outer body wall. - Coelom

B. Completely lacks a body cavity between the digestive cavity and outer body wall. - Acoelomate

C. Has a body cavity lined by tissue derived from the mesoderm and by tissue derived from the endoderm. - Coelomate

D. Has a body cavity completely lined by tissue from the mesoderm. - Pseudocoelomate

E. Germ Layer- Coelomate

Explanation:

Coelom is a fluid filled body cavity which stores food, blood like fluid in it in some animals.

Those organisms which do not possess the body cavity or coelom they are called as acoelomate. Example, Platyhelminths

Those animals which have a body cavity derive from the germinal layers ectoderm, endoderm, and mesoderm are coelomate. Example, Annelids

Those animals which have scattered pouches which are not lined by all germinal layers instead one mesoderm will not be able to form coelom. These are called as pseudocoelomate. For example, Nematodes.

A population of raccoons is thought to be in Hardy-Weinberg equilibrium for a tail-length gene. The frequency of the dominant allele (long tails) is 0.8. When a certain forest was surveyed, the scientist was able to tag 25 animals, which were all long-tailed. Does the lack of short-tailed animals suggest that the population is out of Hardy-Weinberg equilibrium in this forest?
A. Yes, because the survey shows 100% AA individuals, so the short tils must have been selected against.
B. No, because you would only expect 4 of the surveyed racoons to be short-tailed, so they may have been missed by chance.
C. Yes, because 20% of the surveyed raccoons should have been short-tailed.
D. No, because you would only expect 4% of the raccoons to be short-tailed, so they may have been missed by chance.

Answers

Answer:

D. No, because you would only expect 4% of the raccoons to be short-tailed, so they may have been missed by chance.

Explanation:

Due to technical problems, you will find the complete explanation in the attached files

Answer:

D

Explanation:

We experienced a technical problem when submitting the answer to this question. SO, to avoid that, we carefully typed the step-by-step explanation in a word document, made a screenshot of it, and attached it in the image below. The first image shows the technical glitch we experienced and the subsequent images show the explanation of the question.

Thanks.

Height in humans is an example of

Answers

Answer:

Polygenic inheritance

Explanation:

Polygenic inheritance refers to inheritance of a phenotypic characteristics (trait) that is attributable to two or more genes and can be measured quantitatively.

Why did the rabbit with medium size legs
survive?

Answers

Answer:

it was the fittest......

Answer:

cause it didnt have skinny legs that was twiggs ;)

A consistent response in many organisms to changing environmental temperatures is the restructuring of cellular membranes.In some fish, phosphatidylethanolamine (PE) in the liver microsomal lipid membrane contains predominantly docosahexaenoic acid, 22:6 at C-2 of the glycerol-3-phosphate backbone and then either a saturated or monounsaturated fatty acyl group at C-1. Which of the following statements are False?

a. At 10 degrees Centigrade a lower percentage of PE molecules contain saturated fatty acyl groups at C-1 when compared to fish acclimatized at 30 degrees Centigrade.
b. At 10 degrees Centigrade a higher percentage of PE molecules contain saturated fatty acyl groups at C-1 when compared to fish acclimatized at 30 degrees Centigrade.
Ñ. At 30 degrees Centigrade a lower percentage of PE molecules had monounsaturated acyl groups at C-1 compared to that observed at 10 degrees Centigrade.
d. At 30 degrees Centigrade a higher percentage of PE molecules had monounsaturated acyl groups at C-1 compared to that observed at 10 degrees Centigrade.
e. The purpose of membrane restructuring with a change in temperature is to maintain fluidity of the membrane.

Answers

Answer:

The false statements are :

b. At 10 degrees Centigrade a higher percentage of PE molecules contain saturated fatty acyl groups at C-1 when compared to fish acclimatized at 30 degrees Centigrade.

d. At 30 degrees Centigrade a higher percentage of PE molecules had monounsaturated acyl groups at C-1 compared to that observed at 10 degrees Centigrade.

Explanation:

The false statements are :

b. At 10 degrees Centigrade a higher percentage of PE molecules contain saturated fatty acyl groups at C-1 when compared to fish acclimatized at 30 degrees Centigrade.

d. At 30 degrees Centigrade a higher percentage of PE molecules had monounsaturated acyl groups at C-1 compared to that observed at 10 degrees Centigrade.

Reason -

When temperature decreases,  the proportion of unsaturated fatty acids increases and saturated fatty acids decreases that also decreases the fluidity of the membrane and thereby make it stiff.

When temperature increases, the proportion of unsaturated fatty acids decreases and saturated fatty acids increases that makes the cell membrane more fluidic.

So, the temperature changes restructures the membrane with respect to fluidity of membrane.

Therefore,

At 10° Celsius, at C-1 of glycerol, the proportion of unsaturated fatty acids increases and saturated fatty acids decreases.

At 30° Celsius, the proportion of unsaturated fatty acid decreases and saturated fatty acid increases.

How can we use science and math to develop a cost-benefit
analysis to help manage natural resources?

Answers


Cost–benefit analysis (CBA), also known as benefit–cost analysis, is rooted in applied welfare economics. It is a way of organizing and analyzing data as an aid to thinking. It provides a set of procedures for comparing benefits and costs and is traditionally associated with government intervention and with the evaluation of government action and government projects. The underlying rationale for CBA is rational choice; that is, a rational agent will weigh the costs and benefits of any proposed activity and will only undertake the activity if the benefits exceed the costs

Where do winds come from?

Explain your answer.
Explain your answer in your own words.

Answers

Answer:

the air muhj tmef too kik

Explanation:

yoy welum my english noi goed

HELP ASAP I WILL MARK BRAINLIEST PLS NO LINK I DONT WANT TO DO BAD ON THIS ASSIGMENT

The International Space Station (ISS) orbits Earth 254 miles above. It takes about 48 hours to get from Earth to the ISS. What is the average speed of the spacecraft? Round to the nearest hundredth (two decimal places).

Speed =​

Answers

Answer:

Speed= Distance Divided By Time

Distance= 254 Miles

Time= 48 Hours

Speed= 5.29 Approximately

Two pea plants heterozygous for the characters of pod color and pod shape are crossed. Assume that G allele stands for green pod color, g allele−for yellow pod color, I allele−for inflated pod shape, and i allele−for constricted pod shape. Complete the Punnett square for this cross.

Answers

Answer:

Please find the punnet square in the attachment section

Explanation:

This question involves two different genes; one coding for pod color and the other for pod shape. The allele for green pod color (G) is dominant over the allele for yellow pod color (g) while the allele for inflated pod shape (I) is dominant over the allele for constricted pod shape (i).

According to this question, two pea plants heterozygous for both of the characters or traits are crossed i.e. GgIi × GgIi. Each heterozygous parent will produce the following possible gametes:

GgIi - GI, Gi, gI and gi.

Using these gametes in a punnet square (see attached image), the following proportion of offsprings will be produced:

- Green, inflated pods (G_I_) = 9

- Green, constricted pods (G_ii) = 3

- Yellow, inflated pods (ggI_) = 3

- Yellow, constricted pods (ggii) = 1

1) You can see two moths in this image, Living on the bark of trees. They
are the same species of moth; they differ in color. If the habitat of the
two moths does not change, predict what will happen to the moth
population in this area and explain why.
A)
If the habitat does not change there should be no
change in the moth population.
B)
The lighter moth population will have better chance
of survival due to camouflage. Light moths will
increase: dark moths will decrease.
C)
The population will shift to the to favor the light
moth. The light moth population will increase
because the dark moths will leave the area.
D)
As the seasons change, both moths will be hidden by
foliage growing on the trees. We would predict no
big change in the moth populations, light or dark.

Answers

The Correct answer Is B.

this is because of natural selection

hope this helps !

The lighter moth population will have a better chance of survival due to camouflage. Light moths will increase and dark moths will decrease due to industrial melanism. Therefore, option B is correct.

What is industrial melanism?

Industrial melanism is a phenomenon in which the frequency of dark-colored or melanistic individuals in a population of organisms increases as a result of environmental pollution.

This phenomenon was first observed in the 19th century in industrialized regions of England, where the population of peppered moths shifted from mostly light-colored to mostly dark-colored in response to pollution from industrial activities.

Thus, the lighter moth population will have a better chance of survival due to camouflage. Light moths will increase and dark moths will decrease. Therefore, option B is correct.

Learn more about industrial melanism, here:

https://brainly.com/question/15283847

#SPJ5

The following is a list of vessels and structures that are associated with the heart.
 
1) Right atrium
2) Left atrium
3) Right ventricle
4) Left ventricle
5) Superior & inferior vena cava
6) Aorta
7) Pulmonary artery
8) Pulmonary vein
9) Mitral/bicuspid valve
10) Tricuspid valve
11) Pulmonary semilunar valve
12) Aorta semilunar valve
 
What is the correct order for the flow of blood entering the heart from the BODY and leaving for PULMONARY CIRCULATION?

Answers

Answer:

5,1,10,3,11,7,8,2,9,4,12,6.

Drag the tiles to the correct boxes to complete the pairs. Identify the type of energy described in each sentence.

Pairs:
The body stores lipids ingested as fat and uses Thai energy when needed.

A persons hat falls off and lands on the ground.

A wave of water pushes a surfer to shore.

A burner on a stove heats up a tea kettle.

A power plant splits atoms to generate power for a city.

A nerve sends an impulse to another nerve.

A plant absorbs the suns rays to start the process of photosynthesis.

Tiles:
Gravitational Energy
Mechanical Energy
Chemical Energy
Electrical Energy
Thermal Energy
Nuclear Energy
Radiant Energy

Answers

Answer:

chemical energy

gravitational energy

mechanical energy

thermal energy

nuclear energy

electrical energy

radiant energy

Explanation:

Edmentum users .

After a hunt a wolf eats more than it needs at that time. the extra glucose combines to form which substance?​

Answers

Answer:

glycogen

Explanation:

What is the biological impact of minimum catch sizes on a population of fish? a. The population comes to be dominated by smaller, slower-growing individuals. b. Older, less productive adults are removed, improving the population’s health. c. It applies a selective pressure for larger, faster growing fish. d. The fish in the population produce more and healthier eggs to compensate.

Answers

Answer: The population comes to be dominated by smaller, slower-growing individuals

Explanation:

The minimum catch size simply refers to the shortest allowed length that is required for a caught fish. It should be noted that the minimum catch ensures sustainability with regards to the use of fish stocks and also helps in the promotion of the recovery of some fish.

Lastly, a biological impact of minimum catch sizes on a population of fish is that population comes to be dominated by smaller, slower-growing individuals.

Answer:

Explanation:

The answer is A.) The population comes to be dominated by smaller, slower-growing individuals.

Next >
Muscular Strength and Endurance: Mastery Test
4
Select the correct answer.
What must skeletal muscles do to move?
A.
engage their fibers slowly
В.
twitch involuntarily
Oc.
separate from the bone
O D.
contract and relax
Reset
Next

Answers

THE ANSWER IS B TWITCH INVOLUNTARY

What does "fishing down the food web" mean?​

Answers

Answer:

Fishing down the food web is the process whereby fisheries in a given ecosystem, "having depleted the large predatory fish on top of the food web, turn to increasingly smaller species, finally ending up with previously spurned small fish and invertebrates".

Other Questions
What is the function of the digestive system?A. Removal of liquid wasteB. Maintain body temperature and hormone levelsC. Delivers food to your brainD. Changes food into minerals and nutrients that are absorbed intobloodstream A substantiated opinion is best supported bypersonal opinions.individual thoughts.expert opinions.common beliefs. The diagram on the left shows the layers of Earth's atmosphere and how temperature changes with altitude. The diagram on the right shows the layers of Venus' atmosphere and how temperature changes with altitude. Both diagrams indicate the altitude below which 90% of each atmosphere's mass is located.According to the diagrams, which of the following statements is true? A. 90% of the mass of Venus' atmosphere is within 10 km of the surface. B. The upper part of Venus' troposphere is about 200C colder than the upper part of Earth's. C. Venus' troposphere is several times thicker than Earth's troposphere. 6. What aspect of the Compromise of 1850 was attractive to the South? Marcelino Co.'s March 31 inventory of raw materials is $84,000. Raw materials purchases in April are $580,000, and factory payroll cost in April is $387,000. Overhead costs incurred in April are: indirect materials, $59,000; indirect labor, $28,000; factory rent, $32,000; factory utilities, $20,000; and factory equipment depreciation, $52,000. The predetermined overhead rate is 50% of direct labor cost. Job 306 is sold for $680,000 cash in April. Costs of the three jobs worked on in April follow: Job 306 Job 307 Job 308 Balances on March 31 Direct materials $30,000 $41,000 Direct labor 23,000 16,000 Applied overhead 11,500 8,000 Costs during April Direct materials 139,000 200,000 $115,000 Direct labor 103,000 150,000 104,000 Applied overhead ? ? ? Status on April 30 Finished (sold) Finished (unsold) In process Required:a. Determine the total of each production cost incurred for April (direct labor, direct materials, and applied overhead), and the total cost assigned to each job (including the balances from March 31).b. Prepare journal entries for the month of April to record the above transactions.c. Prepare a schedule of cost of goods manufactured.d. Compute gross profit for April 50 points Awarded Simplify the following expression: 3 *3 (4) *2 2 *6 (3) *5P.P is Subscript Warren is making trail mix to keep in his cupboard as a snack. He makes his usual recipe, but then decides to put some peanuts and almonds in the mix. If he adds p cups of peanuts and a cups of almonds, then the total number of cups of trail mix he makes will be 10+p+a. Warren adds 2 cups of peanuts and 1 cup of almonds.How many cups of trail mix did Warren make? the rate of the Earth's and moon's rotation and revolution constant? Someone help are these prepositions or not DOES ANYONE KNOW HOW TO SOLVE THIS?? PLEASE HELP ASAP!! THIS IS LATE! :(Which answer best summarizes the state's responsibilities to the national government under the Articles of Confederation?A. States had to pay taxes set by Congress and provide soldiers during war time.B. States had to provide representatives to Congress but soldiers were sent only to state militaries.C. States sent representatives to Congress and provided soldiers and some officers to protect the country.D. States provided money in the form of taxes, sent representatives to Congress, and had to supply soldiers during war. Help The first one is what is on sale and the bottem is what needs to be solved! Will Give Out BRAINLIEST ANSWER, HELPRead the Seussification of Romeo & Juliet1. What is the name of the play?2. List the main characters3. What is the Rising Action of the play?4. What is the climax of the play?5. What is the setting of the play?6. What is the plot of the play?7. In your own words, give a short synopsis of the plot. 8. If you had an unlimited budget how would you want your set designed? Try to explain in as great as detail as possible. 9. Would you recommend this play to others? Why? Why not? 10.What part of the play would you like to play? 7) The ratio of lipsticks to eye shadow in my makeup bag is 1:9. The ratio of eye shadow to mascara is 3:2. Given that I have 3 more eye shadows than mascaras, how many lipsticks do I have? You are saving money for a summer camp that costs $1800. You have saved $500 so far, and you have 14 more weeks to save the total amount. What are the possible average amounts of money that you can save per week in order to have a total of at least $1800 saved? What are the two types of adaptations that plants can show giving out brainliest answer !!!! help me out asap please !!!! Simplify the expression.4y + 3( y+1) + 2 (x + 5) China is geographically divided into ___________. Tibet and the China Plain Han China and Mongal China Upper and Lower China Inner and Outer China please help me Ill give brainiest to the person who answers these please