Answer:
Phytoplankton and algae form the bases of aquatic food webs. They are eaten by primary consumers like zooplankton, small fish, and crustaceans. Primary consumers are in turn eaten by fish, small sharks, corals, and baleen whales.
Explanation:
Which statement is true about gene expression? Give brainlist is answer right
Cells become specialized because different cells contain different sets of genes
Gene expression occurs primarily when DNA is replicated before the process of mitosis
The DNA of repressed genes gets destroyed because it is not being used
A cell becomes specialized by controlling the which proteins are produced from the cell's DNA
Answer:
I guess All of them
Explanation:
Gene expression has all of these statements as given above in text.
Nancy visits a local reservoir where she feeds ducks and other birds. Every time she feeds them she notices that they fight for the best pieces and some do not get any. All living things struggle to get the necessary amount of food, water, and shelter. What is the term for this struggle?
A. overproduction
B. natural selection
C. variation
D. competition
Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts
Answer:
Name one waste substance the coronary veins will remove.
…………………………………………………………………………………………………..……………………
Tara, a server, has a sore throat. She takes her temperature and it reads 100°F. She should be _____.
excluded from work
allowed to continue her duties as long as she does not start to feel worse
reported to the health department
restricted from working with food
what is the smallest unit of DNA molecule that can be altered by a mutation and cause a change to the coding of polypeptide
What is anatomy?
Simple answer please!
I'll give brainlist
Answer:
Anatomy is the study of the bodies of people and other animals
hope this helps
have a good day :)
Explanation:
Anatomy is the branch of biology concerned with the study of the structure of organisms and their parts. Anatomy is a branch of natural science which deals with the structural organization of living things. It is an old science, having its beginnings in prehistoric times.
2. The formation of male and female sex cells is known as
A) gametogenesis
B) budding
C) sporulation
D) regeneration
Answer:
A . the formation of male and female sex cell is known as gametogenesis
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
sources of potassium for plants
Answer:
mined rock powders and wood ash.
Explanation:
¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada
Answer:
D.Grupos taxonomicos
Explanation:
Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.
Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.
El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.
If a plant develops a toxin, how
might a herbivore evolve in
response?
A. The herbivore will most likely change its diet.
B. The herbivore will eat the plant until it
becomes immune.
C. The herbivore will gradually evolve a
resistance.
Answer:
a
Explanation:
It will probably change it's diet
Answer: A the herivabore will change its diet unless the plant in question is a fundamental key to its survival that C the herbivore will gradually evolve a resistance but the answer would be A as this is not explained in the question.
How has the human population grown in the last 200 years? Why has human population growth accelerated in the last 200 years?
Answer:
1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world. 2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet.
Explanation:
Answer:
1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world. 2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet
Explanation:
Graduate students monitoring the benthic organisms of a freshwater lake take samples at different depths throughout the lake and identify the invertebrate species present. In a deep region of the lake, they discover a crustacean that appears to be a new species. They decide to study its natural history. What is the first thing they should do in this study?
Answer:
Do a literature search to find natural history information on closely related species.
Explanation:
In the context, few graduate students monitored the benthic organisms from the fresh lake water samples and identified the invertebrate species that are present.
They also discover a crustacean which appears to be the new species for which they decided to do a study on its natural history. The first thing that the graduate student should do is to do a literature search for finding a natural history on the information that are closely related species.
which of the following involves mitotic cell division.
a. production of a fertilized egg
b. sexual reproduction
c. asexual reproduction
d. production of gametes
5.
Name three factors that may affect the carrying capacity of the population. (3 points)
Which organism in the food web below is likely to store the most energy?
boa constrictor
beetle
coati
poison dart frog
sloth
strangler fig
fungus
fruit bat
A. Strangler fig
B. Boa constrictor
C. Beetle
D. Poison dart frog
Answer:
Beatle
Explanation:
Beetle in the food web below is likely to store the most energy. So, the correct option is (C).
What is Food Web?A food web is defined as the natural interconnection of food chains and is a graphical representation of what-eats in an ecological community. Food web is also known as consumer-resource system.
A food web consists of many food chains while a food chain follows only one path as animals find food. For example, Falcon eats snake, which has eaten frog, which has eaten grasshopper, which has eaten grass. Thi shows the many different pathways that plants and animals are connected.
In this, the lower trophic level organisms have more energy than the upper trophic level because only 10% of the energy flows from one trophic level to the next. In the above case, beetles have the highest energy compared to other organisms.
Thus, Beetle in the food web below is likely to store the most energy. So, the correct option is (C).
Learn more about Food Web, here:
https://brainly.com/question/18816028
#SPJ2
In your own words, can you explain where a hot
spot can be found AND what does it looks like?
Answer:
well for one you can find a lot for examples like if the light of a blazing hot sun was reflecting on a wooden stick the spot where the sun is reflecting would have a red mark with smoke comming out the stop
Which of the following is a subsystem of an organism?
The similarity of the structures shown in the picture suggests that the organisms_______
1) have a common ancestor
2) all grew at different rates
3) live for a long time
4) evolved slowly
What is the main function of the central nervous system ? E2020
Answer:
The central nervous system (CNS) controls most functions of the body and mind. It consists of two parts: the brain and the spinal cord. The brain is the center of our thoughts, the interpreter of our external environment, and the origin of control over body movement.
Explanation:
Answer:
Main function-the interpreter of the environment and control over body movement.
The central nervous system controls the body and mind. It has two parts, the brain and the spinal cord. The brain is the center of thoughts..
When the homologous chromosomes align at the equator and then separate during meiosis I, they do so randomly. This event supports Mendel’s Law of
Proteins secreted by Gram-negative cells face multiple obstacles, including _____. Multiple choice question. moving across the periplasmic space underlying the thick peptidoglycan layer of the cell wall moving across the plasma membrane moving across the plasma membrane and the thick peptidoglycan layer of the cell wall moving across both the plasma membrane and the outer membrane
Answer:
moving across both the plasma membrane and the outer membrane
Explanation:
Gram-negative bacteria are bacteria that have a plasma membrane, a thin peptidoglycan layer, and an outer membrane (the space between the plasma membrane and the outer membrane is known as periplasm). Moreover, Gram-positive bacteria exhibit neither outer membrane nor periplasmic space and are surrounded by thick layers of peptidoglycan. Gram-negative bacteria have developed different protein secretion systems (types I–VI and type VIII) in order to secrete proteins into the extracellular space. For such purpose, the XcpQ protein (which is an outer membrane protein from the secretin family) participates in different transport processes in Gram-negative bacteria.
A 9.0 is how many times more powerful than a
4.0 on the Richter scale?
Answer:
It increases 31.7 times between whole number
values.
Explanation:
"That is, the wave amplitude in a level 6 earthquake is 10 times greater than in a level 5 earthquake, and the amplitude increases 100 times between a level 7 earthquake and a level 9 earthquake."
Compare photosynthesis and cellular respiration. In what types of cells do these processes occur?
Answer:
Cellular respiration occurs in both plants and animals.
But photosynthesis occurs only in plants. But photosynthesis can happen to 4 animals. It is only an exception, however. Sea slug and pea aphid may perform photosynthesis, oriental hornet, spotted salamander.
Explanation:
ATP is the main energy source of the cell. The most important final product of cellular respiration.The two main final photosynthesis products are glucose and oxygen.
Some of the cellular respiration enzyme reactions occur in the cytoplasm but the bulk is in the mitochondria. Inside the chloroplast, photosynthesis occurs.NADH is the high-energy cellular respiration electron carrier, while NADPH is photosynthesized as a powerful electron carrier.In the cell chloroplasts, photosynthesis is carried out. This process gives energy directly or indirectly to all living organisms. Life on Earth would be no longer there without it.
Although photosynthesis needs energy and produces food, cellular breathing breaks food down and releases energy. Photosynthesis and respiration are carried out by plants while animals can only breathe.
I have no clue and the internet doenst help
Answer:
Soda
Explanation:
These are some weird questions...
I would say the canned soda since machines do most of that work anyway, while things like livestock need more human interaction, meaning more work needs to be done.
helpp mee pleaseeee need help
Answer: it will increase the frequency of the action potential hope this helps
Explanation:
Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms
B. bacteria
C. aliens
D. related
Answer:
Hi, there the answer is D. related
Explanation:
Homologous structures are similar structures in related organisms.
Hope This Helps :)
Answer:
it is d i think
Explanation:
Pls help this is due today
Answer:
scientific method can help resolve problems logically
Answer:
b. scientific
Explanation:
the method most talked about in science is the scientific method. I've never really heard of any of the other methods, they don't make sense with the question anyway.
hope this helps! lemme know if you need more
Which features form along all types of plate boundaries?
Hurry up!!
Explanation:
Ocean ridges features form along all types of plate boundaries.
what are the four primary uses or benefits of the nguni breed amongst South African communities?
Answer:
Utility: The Nguni cattle are used for milk and meat; their socio-cultural functions are also important. The body conformation of the Nguni is more of a dairy than beef type but it is principally used for beef production and for work.
Explanation: