GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

GTA: TAA MRNA UCA : CAU: AUU TRNA AGU : GUA : UAA RRNA Serine Valine Stop You Need To Solve The Entire

Answers

Answer 1

Answer:

u want step by step?

Explanation:


Related Questions

best answer gets brainliest

Answers

Answer:

1) Crest

2) Trough

3) Wavelength

How long does the repair stage last in bone healing?

How does it last like some years what time

Answers

Answer:

it depends on the type of injury people usually stop feeling pain long before the broken bone has healed such as a fractured bone can take up to 6-8 weeks

Explanation:

Answer:

Repairing or reparative phrase begins within the 1st few days after the bone fracture last for about 6 to 8 weeks. During this time, the body develops cartilage tissue in and around the fracture site. Children's bones normally heal faster than adults.

hope this helps

What are cell biology, genetics, and
molecular biology?

Answers

Answer:

Explanation:

Cell biology (also cellular biology or cytology) is a branch of biology studying the structure and function of the cell, also known as the basic unit of life. Cell biology encompasses both prokaryotic and eukaryotic cells and can be divided into many sub-topics which may include the study of cell metabolism, cell communication, cell cycle, biochemistry, and cell composition.

Genetics, study of heredity in general and of genes in particular. Genetics forms one of the central pillars of biology and overlaps with many other areas, such as agriculture, medicine, and biotechnology. Learn more about the history, biology, areas of study, and methods of genetics.

Molecular biology, field of science concerned with studying the chemical structures and processes of biological phenomena involving molecules. In particular, researchers focus on DNA, RNA, and proteins and their interactions. As a result, the field is closely related to genetics and biochemistry

The study of heredity is a field of genetics and cell biology. The DNA itself (molecular genetics), entire populations, or whole creatures are investigated at various levels of genetics (population and evolutionary genetics).

What relation between cell biology and molecular biology?

Two branches of biology are cell biology and molecular biology. The study of cellular mechanisms is a focus of the subject of cell biology.

As a result, it primarily concerns the functions and architecture of the cell. The study of molecular level mechanisms is a focus of the science of molecular biology.

Therefore, cell biology, genetics, and molecular biology are interconnected.

Learn more about cell biology and molecular biology here:

https://brainly.com/question/28782190

#SPJ2

As elevation increases, temperature decreases. At which elevation will sound travel fastest?

2,000 meters
1,500 meters
1,000 meters
500 meters

Answers

Answer:

it was 500

Explanation:

i was confused at first, lol

Answer:

500

Explanation:

DNA Base Pairing Worksheet
There are base pairing rules for writing complimentary DNA strands for a given strand.
A pairs with T
C pairs with G
In RNA, A pairs with U, instead of T.
Write the complimentary DNA strand for each given strand of DNA.
1. GGCATTCGCGATCATG
2. CGTTAGCATGCTTCAT
3. ACTAACGGTAGCTAGC

Answers

Answer: 1. CCGTAAGCGCTAGTAC

2.GCAATCGTACGAAGTA

3. TGATTGCCATCGATCG

Explanation: you just flip the letters with their corresponding ones

When an antigen attacks the body, it activates adaptive immunity. This adaptive immunity produces a strong response when it encounters the same antigen for the second time. Which feature of adaptive immunity is essential for this kind of response?

Answers

Answer:

A) the ability to remember the antigen it encounters

Adaptative immunity reacts in a more general way producing nonspecific antibodies against the foreign antigen when the organism is first attacked by that foreign antigen. The second time around, when the organism is faced again with the same foreign antigen, it produces a much stronger response because it memorised the antigen and is not strange anymore so the response can be more specific, quicker, and effective.

Explanation:

Answer:

Explanation:

memory T cells plays an important role in fighting against microbe which encounter the body for second time

What are some applications of biotechnology?

Answers

Biotechnology can be used to transform bacteria so they are able to make human proteins, such as insulin. It can also be used to create transgenic crops, such as crops that yield more food or resist insect pests. (I copied this off the web so just paraphrase)

Answer:

Health careAgricultureIndustrial uses of crops/other productsEnvironmental uses

Credit goes to: wikipedia

I hope this helps!

i need help
i need ideas. Basically, you Create a story to teach class of 2024 and 2025 how to be good students. but its an Extra Credit Opportunity - Student Fable assignment.
i cant think of any ideas

Answers

Let me help you here :)

Start by presenting yourself, your name, where you from, etc. Then you can explain why is it important to complete all your assignments and study to get good grades... You can also talk about how High School will reflect in your future and applications for colleges. In your story write how important is to always pay attention in class and listen to your teacher.
Hope this helps!!

pls help me idk how to do this​

Answers

hi!! the water cycle goes:

evaporation, condensation, precipitation

hope this helps!!

Compared to historical trends, what is different about
contemporary climate change?


A. It’s occurring faster
B. It’s a warning trend
C. It’s affecting plants and animals
D.it’s caused by atmospheric changes

Answers

Answer:

c

Explanation:

The answer to your equation is C. Hope this helps!

which nuetrom delivers info to the central nervous system

Answers

Answer:

sensory neuron

Explanation:

A plant can have green (G) or yellow (g) leaves. it can also have a long (k) or short (k) stem. A scientist is preparing a Punnett square for a dihybrid cross of a plant with a genotype GGKk what possible gametes can the plant produce?

Answers

Answer:

gk, gK

Explanation:

GK, Gk, gk, gK are the possible gametes can the plant produce. So, the correct option is A.

What are Gametes?

Male and female germ cells are created in the anther and ovule of flowering plants, respectively. Pollen grains, which are discharged from the anthers at anthesis, contain male gametes.

The generative cell relocates through the pollen tube formed by the tube cell during pollen germination to reach the ovary's base where it will be fertilized. The generative cell splits into two male gametes as it moves through the pollen tube.

In the given example, the following gametes could be created while creating a Punnett square:

=> GK (Green and long) (Green and long)

=> Gk (Green and short) (Green and short)

=> gK (Yellow and long) (Yellow and long)

=> gk (Yellow and short) (Yellow and short)

Therefore, the correct option is A.

Learn more about Gametes, here:

https://brainly.com/question/29882202

#SPJ7

Your question is incomplete, most probably the complete question is :

A plant can have green (G) or yellow (g) leaves. It can also have a long (K) or short (k) stem. A scientist is preparing a Punnett square for a dihybrid cross of a plant with a genotype GGKk. What possible gametes can the plant produce?

A) GK, Gk, gk, gK

B) GG, Kk

C) GK, Gk

D) GK, gk

A low-mass star is most likely to end its life cycle as a
a. protostar
b.black hole
c. supernova
d. black dwarf
PLEASE ANSWER SOOOOON sorryyy

Answers

Answer:

Explanation:

Black dwarf

A coal mine has been set up in a location. Thus far, it has benefited the people by increasing employment opportunities in the area. What is the most likely outcome the coal mine will have on the environment?

It will produce greenhouse gases, which pollute drinking water.
It will cause evaporation of clean water from rivers and streams.
It will contaminate groundwater and sources of drinking water.
It will destroy plants, which keep the groundwater clean.

Answers

Answer:

it will contaminate the water, choice C

Explanation:

i took the quiz

Which statement below does NOT correctly describe water's chemical
properties?

a. Water is a neutral substance - it is neither a base or acid

b. Water is an inert substance

c. Water is not flammable or combustible

d. Water is reactive and catalyzes many reactions that take place inside living things

Answers

Answer:

b.

Explanation:

This is incorrect, because, "water is a powerful accelerator of chemical reactions."

Credit to www.astronno.com

write the UNBALANCED chemical equation for photosynthesis. don't forget to include energy

Answers

Answer:

ubalanced chemical equation for photosynthesis

After intense activity, your muscles feel sore because of
the accumulation ofNAD+ B-
the accumulation of ATP
C- the accumulation of lactic acid D- the accumulation of carbon dioxide​

Answers

Answer:

After intense activity, your muscles feel sore because of _____. a) the accumulation of NAD+ b) the accumulation of lactic acid c) the accumulation of ATP d) the accumulation of carbon dioxide. B. ... ATPc "carbon planet," because carbon is the central element in organic compounds. ... After intense activity, your muscles feel sore because of a. the accumulation of NAD+. b. the accumulation of lactic acid. c. the accumulation of ATP. d. the accumulation of carbon dioxide. b. the accumulation of lactic acid.

Explanation:

srry if this dosent help

I can give brainliest if someone can answer these and 30 points but please make sure your right and don't just take the points:).

Answers

Answer:

I shouldn''t put your full name on there

Explanation:

you should have cropped your image we can see your full screen

Which of the following is not a cause of a tsunami?

Question 5 options:

Earthquake


Volcanoes


The moon


Landslides

Answers

The moon moon moon moon

Explanation:

moon

A Tsunami is a huge tide or a series of killer waves that have the ability to move a large quantity of water.

The Tsunamis are a product of earthquakes, landslides and volcanic eruptions as they displace a large amount of water from the land surface. Being seismic waves these Tsunamis are able to destroy property and cause havoc on life forms. The moon comparatively is located at a distance of 384,400 km and thus causes high and low tides. The moon does not possess a large gravity potential to cause a Tsunami on earth.

Hence the correct option is C.

brainly.com/question/19162159.

Can someone help me with this question please?

Answers

Answer:

B

Explanation:

They use echolocation (sound waves) because they cannot see the bottom of the ocean.

Good luck!

In guinea pigs, the allele for a smooth coat (S) is dominant over the allele for a rough coat (s). Explain how you could find out whether a guinea pig with a smooth coat is a hybrid or a purebred.

Answers

Answer:

Explanation:

First of all you need to have ss because this is recessive.

Secondly there is 2 option for Dominant one

It could be Ss or SS so if you wanna know what is what you need to use recessive gen

S- ss if all genes are hybrid dominant one would be SS if some genes aren’t hybrid dominant one would be Ss

What's the connection between epigenome and nature vs nurture?

Answers

Answer:

The survival and proper functioning of an organism depends on a finely tuned interface between genome and environment, nature and nurture. The interface that regulates gene expression through environmental feedback is called the epigenome.

Explanation:

Activity
The picture shows five different embryos. Study the picture, and then answer the questions.
What similarities and differences do you notice among the different embryos?

Answers

Answer:

I can tell you some difference but I cant find similarities

Explanation:

they each have thier own heat area

they are each a different breed

they each have thier own cold area

they each come from a different family tree

this all I can really see I hope this helped at least a bit

Answer:

All the embryos have a similar wormlike shape, but they have different features. For example, the amphibian has a large bubble shape in the middle and the fish has a smaller bubble shape. The others don’t have a bubble shape.

Explanation:

Got it off of Edmentum :)

A population of antelope lives on the African Savannah and is hunted by lions. Explain how a mutation that allows some antelope to run faster than others might lead to the evolution of this population . *
3 points
Your answer

Answers

Answer:

The individual carrying this beneficial mutation will be selected through natural selection.

Explanation:

Mutations are genetic changes in the DNA sequence. When mutations occur in the germline, these genetic modifications can pass from one generation to the next. In general, mutations are deleterious, but there are exceptions where they may be beneficial for the individual and provide the raw material for evolutionary change. An individual carrying one beneficial mutation will have more chances to survive and reproduce than individuals without this mutation, and thereby such genetic change will increase its frequency in the population.

what do chromosomes store?

Answers

Answer:

A chromosome is a single, long molecule of DNA. These highly organized structures store genetic information in living organisms. Small sections of the chromosome, called genes, code for the RNA and protein molecules required by an organism.

Which letter marks the location where carbon dioxide is
produced during respiration?
OW
ОХ
Ο Υ
Ο Ζ

Answers

the answer fo this i think it’s OX

Letter X represents the Mitochondria which marks the location where carbon dioxide is produced during respiration. So, the correct option is B.

What is Mitochondria?

A mitochondrion is defined as an organelle which is found in the cells of most eukaryotes, such as animals, plants, and fungi that have a double membrane structure. It uses aerobic respiration to generate adenosine triphosphate, which is used throughout the cell as a source of chemical energy.

The main role of mitochondria is oxidative phosphorylation which utilizes the energy released during the oxidation of the food we eat to generate ATP which is used as the primary energy source for most biochemical and physiological processes such as growth, movement and homeostasis.

So, the correct option is B.

Learn more about Mitochondria, here:

https://brainly.com/question/29763308

#SPJ7

How are the krebs cycle and the electron transport chain related?

Answers

They are related because they both are involved in the process of producing atp.
The Krebs cycle creates vitamin c, heat and a little bit of atp.
Then the process of electron transport helps to produce the rest

PLEASE HELP ME!!!!!!
What happens to the muscles when the weight is lowered?

Answers

Answer:

C is the answer to the question

Was perestroika successful?

Answers

Answer:

Nope, it dissolved before reaching the final stages.

I hope that helps :D

In what atmosphere layer do human live most of their lives

Answers

Answer:

troposphere

This is the lowest part of the atmosphere - the part we live in. It contains most of our weather - clouds, rain, snow.

Other Questions
What are some of the factors that might have facilitated Chinggis Khan's conquest of the East? Helpp pleaseeee i will make brainliest! Gregor Mendel studied pea plants to determine the patterns of inheritance. What is not a reason Mendel used pea plants in his experiments? Check all that apply. Carla rode her bike30 miles in 2 1/2hours. PROBLEM I WITHOUT A CALCULATOR)1. A room is warming up such that the temperature rise, in degrees Fahrenheit, is proportionalto the time the room has been heating. After 4 minutes, the room temperature rose 12 F.(a) What is the constant of proportionnlit for the Please help the midsegment of ABC is LM what is the length of AL if LB is 20 inches long?a. 10b. 40c. 20d. 30 PLEASE HELPPP :[When a chemical change occurs a new substance is created. Harvey put hamburgers on his barbecue, and they cooked. He left fruit out on the counter and they started to rot.What evidence about chemical changes can Harvey use to support the examples in his experiment? A.The chemical changes occurred because the chemicals changed.B. The chemical changes occurred because there was a change in light energy.C. The fruit and the hamburgers were affected by an increase in heat energy.D. The fruit and the hamburgers were affected by a decrease in heat energy. If 10 cm on a map represents 25 km of actual ground, how many centmetres would 45 km of actual ground be on the map? Which of the following statements accurately describes why Venus is the hottest planet?A It has a lot of volcanoes.BIt produces its heat through fusion.It is closest to the SunC It has a very thick atmosphere that holds in heat. Hey guys! Can you simplify this? Be sure to show your work so i know you aren't guessing! Also remember when you answer a question and your answer gets reported and deleted you lose the points you received! So don't put incomplete, absurd, plagiarism answers!4x+49 Read the excerpt from a short story. I thanked her again for the cake, and quietly retreated from the porch. A blast of air conditioning assailed me as I reentered our home and closed the summer heat behind me. Placing the cake on the table with the others, I noted its carefully scalloped frosting with mounting sadness. Clutching the doorjamb, I suppressed a sob. The reality of our loss would wait. Which words from the excerpt convey the tone? thanked and retreated assailed and reentered placing and scalloped clutching and suppressed Which is bigger 9/5 or 9/10 1. How isotopes of copper are Cu-63 and Cu-65. How are these two isotopes the same? How are they different?2. What is an isotope?3. Why do elements in the same group have similar chemical properties?4.What are valence electrons? 5.Write the symbol for each of the following elements:The halogen in period threeThe alkali metal in period twoThe noble gas in period oneThe alkaline earth element in period sixAny transition metal in the 5th periodA metaloid in group 14A nonmetal in group 166. What are two differences between a metal and a nonmetaPLEASE ASAP!!!!!!!!!!!!!! what is x if f(x) is 64 in the function below?f(x) = 4^x Two groups are going on a trip to the theater. The first group has 30 students in for adult chaperones. The second group has 25 students in for adult chaperones. The cost, in dollars, for each student ticket, S, and each adult ticket, A, can be determined using the system of equations below FIRST ANSWER GETS BRAINLIEST write a paragraph about why the African Elephants were endangered. story that ends with do not count your chicken before they hatch what would represent represent the genotype of a heterozygous pea plant?'A.whiteB.purpleC.PPD.Pp Help!!!By rounding each number to 1sf. Estimate the answer to 7.238 125.5413 5. 1575 was shared among three people in the ratio 1:2:1/2Calculate the smallest share.