i really need help... factor by the simplest form 46xy^5

Answers

Answer 1
The simplest form is 46xy
Since 46 can not be factor out, there is only one x which stay there, and is 5 so the two pairs of y will be canceled and one y left.

Related Questions

FOR 20 POINTS r(x)=−7x−3 and q(x)=r(−3x).

What equation shows the correct rule for the function q?


q(x)=21x

q(x)=21x−3

q(x)=21x+9

q(x)=21x+3

Answers

Answer:

last one

Step-by-step explanation:

Answer: the correct answer is B the guy above me is wrong

Step-by-step explanation:

Is the sequence {4, 7, 10, 13, 16, ...} a function? Explain.

a
Yes, because each input is a natural number with multiple output numbers in the sequence

b
Yes, because each input is a natural number with a single output number in the sequence

c
No, because there are no input values paired with a single output number in the sequence

d
No, because there are multiple input values paired with a single output number in the sequence

Answers

Step-by-step explanation:

tricky, as the sequence does not define the input values.

by we can assume that the corresponding input values are 1, 2, 3, 4, 5, ... as it is usual for a sequence.

in that sense, b is the correct answer.

The sequence is a function because each input is a natural number with a single output number in the sequence.

What is arithmetic progression?

The difference between any two consecutive integers in an arithmetic progression (AP) sequence of numbers is always the same amount. It also goes by the name Arithmetic Sequence.

Given the sequence {4, 7, 10, 13, 16, ...},

Given that each term has a common difference, this is an arithmetic sequence. In this instance, the next item in the sequence is obtained by multiplying the previous term by 3.

a₂ - a₁ = 7 - 4 = 3

a₃ - a₂ = 10 - 7 = 3

the difference in output is the same for all the numbers in sequence.

Hence the sequence is the function of the Arithmetic Sequence.

Learn more about arithmetic progression;

https://brainly.com/question/16947807

#SPJ2

The following are the ages of 13 mathematics teachers in a school district.
29, 30, 32, 38, 39, 43, 43, 44, 45, 46, 46, 57, 60
Notice that the ages are ordered from least to greatest.
Give the five-number summary and the interquartile range for the data set.
Five-number summary
Minimum:
a
Lower quartile:
Median:
0
Upper quartile:
Maximum:
Interquartile range:

Answers

Answer:

Minimum: 29

Lower Quartile: 35

Median: 43

Upper Quartile: 46

Maximum: 60

Interquartile Range: 11

Step-by-step explanation:

What is an
equation of the line that passes through the point (-8, -1) and is
parallel to the line x– 4y = 4?

Answers

Answer:

y=1/4x + 1

Step-by-step explanation:

first equation,,y=1/4x - 1

G1 = G2

G2 = 1/4

y+1 /x+8 =1/4

4y = X + 8 -4

4y =x + 4

y = 1/4x + 1

Find the value of x?

Answers

Answer:

145°

Step-by-step explanation:

See the attachment.  Angles A, B, and C all belong to the triangle.

We know that A + B + C = 180° since the angles of a triangle always add to 180°.  We also know that when two lines meet that their sum is also equal to 180°.  So we can write for each interior angle the following:

                                     Result

<A = (180 - 88)                72

<B = (180-x)                  180-x

<C = (180 - 127)               53

The sum of angles A, B, and C is equal to 180:

 72 + (180-x) + 53 = 180

x = 145

Find the area of the parallelogram

Answers

Answer:

A = 99.84 cm²

Step-by-step explanation:

The area (A) of a parallelogram is calculated as

A = bh ( b is the base and h the perpendicular height )

Here b = 9.6 and h = 10.4 , then

A = 9.6 × 10.4 = 99.84 cm²

Step-by-step explanation:

We can see that this parallelogram is two right angles joined side by side. Normally the area of a parallelogram is Base x Height.

But let's make an exception.

For the first right angle. The area = 1/4(b+h)

¼(10.4+9.6) = 5cm²

We see that the base of the triangle is flipped and the angles correspond

so, the area would be 5cm² * 2

= 10cm²

A cylinder has a height of 7 centimeters and a diameter of 24 centimeters. What is its volume?

Answers

Answer:

[tex]to \: know \: \: the \: solution[/tex]

[tex]refer \: to \: the \: attatchment[/tex]

I hope this helps you !!

anyone can have few minutes to help!!

Answers

Answer:

i am not sure

Step-by-step explanation:

A large tank was filled with water at a constant rate. The time and amount were recorded in the table.
Complete the table below to show how many gallons of water are in the tank after 335 and 405 minutes?

Time (minutes) 5 110 215 260 335 405
Amount (gallons) 1 22 43 52

Answers

Answer:

67 gallons at 335 minutes

81 gallons at 405 minutes

Step-by-step explanation:

I plotted the points and determined they form a straight line, with a slope of 3 and a y-intercept of 0.

In the form of y=mx+b,

this fill behavior can be represented as y = (1/5)x + 0, or y = (1/5)x

y is the volume in gallons and x is the time in minutes.  The slope, (1/5), is the rate of filling the tank, in gallons/minute.

The solutions for 335 and 405 minutes may be found either by marking them on the graph (attached), of by simple calculation:

At 335 minutes, y = (1/5)(335), or 67 gallons

At 405 minutes, y = (1/5)(405) = 81 gallons

Find EG

Please help

Answers

Answer:

EG = 12.2

Step-by-step explanation:

Since HG = HE = 14 then the triangle is isosceles.

HF is a perpendicular bisector of EG , then

EF = FG = 6.1 , so

EG = EF + FG = 6.1 + 6.1 = 12.2

#1: Find the value of X. (GEOMETRY)

I will give brainliest to BEST answer! fake answers will be reported.
refer to attachment!

Answers

Answer:

x = 14

Step-by-step explanation:

1. We know that all angle measures in a triangle sum to 180 degrees.

This means that 7x - 11 + 5x - 2 + 2x - 3 = 180.

2. (Solving)

Step 1: Combine like terms.

[tex](7x+5x+2x)+(-11-2-3)=180[/tex] [tex]14x -16 = 180[/tex]

Step 2: Add 16 to both sides.

[tex]14x - 16 + 16 = 180 + 16[/tex] [tex]14x = 196[/tex]

Step 3: Divide both sides by 14.

[tex]\frac{14x}{14}=\frac{196}{14}[/tex] [tex]x = 14[/tex]

Step 2: Check if solution is correct.

[tex]7(14)-11+5(14)-2+2(14)-3=180[/tex] [tex]98-11+70-2+28-3=180[/tex] [tex]180=180[/tex]

Therefore, the answer is x = 14.

What’s the answer?? I need asap!

Answers

Answer:

120°

Step-by-step explanation:

Opposite angles in a cross of 2 lines like this are equal;

A = 120 and B = D = 60°

Answer:

∠ A = 120°

Step-by-step explanation:

∠ A and 120° are vertically opposite angles and are congruent , so

∠ A = 120°

1. Nathan bought a bicycle for $230 at an auction. He fixed it up and sold it at a 30% markup. How much did
Nathan sell the bike for?

Answers

If you are marking off a price that means you are ADDING to your final price because Nathan needs a profit for his bike. So to find the final price let’s add 30% of the original price to the final price by multiplying 230 by 0.30 which equals to 69 so then we add 69 to 230 which will be 299. So our final price is $299 dollars with the markup.

Nathan bought a bicycle for $230 at an auction. Nathan sells the bike for $299 at a 30% markup.

What is the percentage?

A percentage is a minimum number or ratio that is measured by a fraction of 100.

Nathan bought a bicycle for $230 at an auction. He fixed it up and sold it at a 30% markup.

So, the markup price, we get

30% of $230

= 30/100 x 230

= 3 x 23

= 69

Total selling price = 230 + 69

                             = 299

Thus, Nathan sells the bike for $299.

Learn more about percentages;

https://brainly.com/question/23111313

Need help fast on hs geometry please

Answers

Here, the two angles are equal.So, it is an isosceles triangle.So, the two opposite sides to the equal angles will be equal.Therefore, XY = YZ

[tex]\begin{gathered}15 = 4x + 3 \\ = > 4x = 15 - 3 \\ = > 4x = 12 \\ = > x = 3\end{gathered}

15=4x+3

=>4x=15−3

=>4x=12

=>x=3[/tex]

Therefore, YZ = 4x + 3 = 4(3) + 3 = 12 + 3 = 15

Answers:

3, 15

Hope you could get an idea from here.

Doubt clarification - use comment section.

At what point(s) does the parabola,

y

=

x

2



2

, intersect the line,

y

=



x

Answers

Answer:

Please check the formatting when posting.  I'm assuming these are the equations:

y=x^2 - 2

y=−x

Step-by-step explanation:

We can either graph the equations or solve them.  I use graphing - see the attachment.  The lines intersect at (-2, 2) and (1,-1)

1.  Graphing

See attached graph

(-2, 2) and (1,-1) are the intersection points

2.  Solving

y=x^2 - 2  Use y=−x in this equation:

-x = x^2 - 2

0 = x^2 + x - 2

0 = (x+2)(x-1)

x = -2 and +1

(-2, 2) and (1,-1) are the intersection points

fill in blanks plz hurry due tmrw

5/7of ... is 5/21

... is blank

Answers

[tex]\dfrac 57 \cdot x = \dfrac 5{21}\\\\\\\implies \dfrac x 7 = \dfrac 1{21}\\\\\\\implies 21x = 7\\\\\implies x = \dfrac{7}{21}\\\\\\ \text{Hence}~\dfrac 57 ~ \text{of}~~ \dfrac{7}{21}~ ~\text{is}~ \dfrac{5}{21}[/tex]

Rotation 180 counterclockwise around the origin of the point (-3,-7)

Answers

Answer: (3 , 7)

Step-by-step explanation: When rotating a point 180 degrees counterclockwise about the origin our point A(x,y) becomes A'(-x,-y). So all we do is make both x and y negative. Since x and y are already negative, they become positive due to the double negative rule.

given a1 = -1 and a4 = -8 what is a10

Answers

Answer:

The nth term of the sequence is given. Find the first 4 terms, a10, and a15 2 What is the first term? a1 = (Type an integer or a simplified fraction.) What is the second term? a2 = (Type an integer or a simplified fraction.) What is the third term? a,-| (Type an integer or a simplified fraction.) What is the fourth term? a4(Type an integer or a simplified fraction.) What is the tenth term

Find the domain and range of the function represented by the graph . What’s the domain an range

Answers

b, remember the domain is the x values, and the range is the y values

It takes Amy twice as long to deliver papers as it does Nancy. How long would it take each girl to deliver the papers by herself if they can deliver the papers together in 36 minutes?

Answers

Answer:

so if it takes twice all long for amy as nacy that means

Amy takes 2/3 or 0.6(aprox)

Nacy takes 1/3 or 0.3(aprox)

Amy=24

Nacy=12

Hope This Helps!!!

The base of a triangular field is three times its height. If the cost of cultivating the feild at $36 per hectare is $486, find its base and height.

Please explain also​

Answers

Answer:

Formula of the area of triangle = 1/2 × b × h (where 'b' is the base and 'h' is the height)

1 hectare = $36

$486 = 13.5 hectares

13.5 hectares = 1/2 × b × h

To get b × h, you use the reverse of the formula. Hence:

13.5 = 1/2 × b × h

13.5 ÷ 1/2 = b × h

               = 27

27 is b × h.

The question states that the base is three times the height. Hence:

b = 3u

h = 1u

b × h = 27

        = 3u × 1u

Thus, we need to find one value which is three times the other, in order to get a product of 27.

Factors of 27:

1 × 27

3 × 9

9 is three times of 3. Thus, the base is 9, while the height is 3.

If I make 2,500 dollars a minute.How much money will I make in 8 hours?

Answers

Answer:

1200000

Step-by-step explanation:

First, convert the 8 hours into minutes 8 hours * 60 minutes = 480 minutes

Then just do 2500 dollars * 480 minutes = 1200000

Answer:

$1,200,000

Step-by-step explanation:

We 1st multiply 2,500 by 60 due to 60 minutes being in 1 hour and get 150,000

We now know that in 1 hour you make 150,000 and to find out how much you make in 8 we then multiply 150,000 by 8 which equals $1,200,000.

I hope this helps have a great day and happy holidays :)

empat angka setelah angka tiga

Answers

Answer:

hindi ko po gets

yan sorry

If one of you guys wouldn’t mind helping me do this question it would really speed up the process I have like 10 minutes now

Answers

Answer:

13. 70(two digits 7 times 10 which is a multiple of 5)

Hope This Helps!!!

write an equation in slope intercept form for the line that passes through the point, and is perpendicular to the line y=-1/3x+9;(-6,-2)

Answers

Answer:

Step-by-step explanation:

y=-1/3x+9

This is written in the format y=mx+b, where m is the slope and b the y-intercept (the value of y when x=0).

Perpendicular lines have a slope that is the negative inverse of the slope of the reference line, in this case -(1/3).  The new slope is 3.  equation is:

y = 3x + b

To find b, enter the given point, (-6,-2) and solve for b:

y = 3x + b

-2 = 3(-6) + b

-2 = -18 + b

b = 16

The full equation is y=3x + 18

Johnathan is driving from Houston to Seattle. After 3 hours, he has traveled 150 miles. After 7 hours, he has traveled 350 miles. This information is also represented in the table below.

Driving Time

Time (hr) Distance (miles)
3 150
7 350
10 500

What is Johnathan’s average rate of speed?

Answers

Answer:

50mph

Step-by-step explanation:

first divide 150 by 3 and you get 50

then divide 350 by 7 you get 50

and finally divide 500 by 10 and you get 50

Which values for A and B will create infiniely many solutions for this system of equations

Answers

Answer :

4x-ay=15

Step-by-step explanation:

(9,11)(9,3) find the slope and explain
please

Answers

Answer:

0

Step-by-step explanation:

y2-y1/x2-x1

11-3/9-9

8/0

0

slope=0

what are the correct answers?

Answers

cos (75)=cos (15) nothing square and check

Write an equation in the form
Y = mx +b to represent the line on each
graphy
40
3

2
st
14 - 2
T
IT
1
-2
3

ha

*
H
H
Sz

Answers

Number 44 is y = -1/2x-1

Number 45 is y= -x+5
Other Questions
which best explains the impact of european colonization on the inca and aztec civilizations? When is it best to solve a system of equations using substitution? As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg) Simplify this question Look at the circuit given below. It consists of a cell, a bulb with two terminals X, Y and wires. P, Q, R and S are positions marked. What is the direction of the flow of current? a) PQXYRS b) SRYXQP c) SPQXYR d) PSRYXQ WILL REPORT WRONG OR TROLL ANSWERS Which word in the passage most clearly shows the speaker's bias against the candidate? Senator Roberts has no experience as a county commissioner, and she is clearly hopeless. A. commissioner B. clearly C. hopeless O D. experience SUBMIT how long does it take from the time beans are planted until they are harvested Help help help please pelsss please