need help with this problem

Need Help With This Problem

Answers

Answer 1

Answer:

x = 6

Step-by-step explanation:

Answer 2

Answer:

Step-by-step explanation:

tan30 = x/12

x = 12tan30

x = 12(sin30/cos30)

x = 12(½ / ½√3)

x = 12/√3

x = (12/3)√3

x = 4√3


Related Questions

9
11 (a) Grapes cost £2 per kilogram.
Calculate the cost of 380g of grapes.

Answers

Answer:

£0.76

Step-by-step explanation:

1kilogram = 1000grams

1000g of grapes costs £2

380g costs = (380 × 2)/ 1000

760/1000 = £0.76

PLEASE HELP ASAP! harold makes a plan to save $500 per month for the next 5 years. He is depositing it in an interest bearing account at 2% APR (compounded monthly). What will be Harold’s balance at the end of 5 years?​

Answers

Answer:

50

Step-by-step explanation:

What is the answer to 1010 + 0101? (Binary) *​

Answers

Answer:

1111 is the answer to your question.

Example 8: Over the track-and-field season, the height Fred cleared in the high jump increase from 1.81 m to 1.96 m. a) Find Fred's percent increase in height. W b) What final height would Fred have to clear for a 20% increase in height over the track-and-field season?​

Answers

Answer:

a. about 8.3%

b. 2.172 m

Step-by-step explanation:

a. 1.81 * x = 1.96

x = 1.083

Percent increase is approximately 8.3%

b. 1.81 * 1.2 = x

x = 2.172 m

I NEED HELP WITH THESE
I am pretty sure of my answers, so I just need someone to double check. Explanation is not needed because I know how to solve it, just needs to be checked. You can put one it you want.

Answers

Answer:

(b) 500 km (b) 6 seconds

Step-by-step explanation:

1.

The semi-major axis length is √47196900 = 6870 km. That distance from the center of the Earth means the satellite is ...

  6780 -6370 = 500 . . . km

from the surface of the Earth.

The satellite is a maximum of 500 km from the Earth.

(It is a minimum of 250 km from Earth.)

__

2.

The equation has a zero at t=6. When the car's velocity is zero, it is at a complete stop.

The car comes to a complete stop when time is 6 seconds.

(The car is still being accelerated, so it doesn't stay stopped.)

__

I prefer a graphing calculator for a quick solution. You can also solve this equation algebraically.

  0 = 0.5t^2 -10.5t +45 . . . . t when v(t) = 0

  t^2 -21t +90 = 0 . . . . . . . multiply by 2

  (t -6)(t -15) = 0 . . . . . . . . factor

  t = 6 or t = 15 . . . . . . . only t=6 is in the domain of the function

x + 7 when x = -11
What is the answer

Answers

-3!!!!!!!! Is the answer have fun and I hope you get this right

- z > 8 equivalent inequality

Answers

Answer: z < -8

Step-by-step explanation:

Since z is negative, divide both sides by -1, which leaves you with z > -8.

Multiplying or dividing an inequality by a negative number flips the sign, thus the answer is z < 8.

Correct me if I am incorrect.

(x - y + z) : (y - z + 2w) : (2x + z - 10) = 2:3:5 Then ( 3x + 3z - 2w) : w = ?pgvzcmckyc?​

Answers

Answer:

19

Step-by-step explanation:

in question given ,x = 2, y = 3, z = 5 in this way

(3x+3z+2w) and find the value of w . according to given values and put

Answer:

  4 +30/w . . . . for any w≠0

Step-by-step explanation:

The given constraints resolve to 2 equations in 4 unknowns. There are an infinite number of solutions.

The ratio requirement means ...

  (x -y +z)/2 = (y -z +2w)/3 = (2x +z -10)/5

Considering the first equality, we can multiply by 6 and subtract the right side.

  3(x -y +z) -2(y -z +2w) = 0   ⇒   3x -5y +5z -4w = 0

Considering the first and last expressions, we can multiply by 10 and subtract the right side.

  5(x -y +z) -2(2x +z -10) = 0   ⇒   x -5y +3z = -20

These two equations have solutions ...

  x = 10 -z +2w

  y = 6 + 0.4z +0.4w

Using these expressions in the ratio of interest, we have ...

  (3x +3z -2w) : w = (3(10 -z +2w) +3z -2w) : w = (30 -3z +6w +3z -2w) : w

  = (30 +4w) : w

Expressed as a mixed number, the ratio of interest is ...

  (30 +4w)/w = 4 +30/w . . . . an infinite number of solutions

__

For positive values of w that are divisors of 30, there are 8 possible values:

   (w, ratio) = (1, 34), (2, 19), (3, 14), (5, 10), (6, 9), (10, 7), (15, 6), (30, 5)

_____

Check

It might be interesting to substitute the expressions for x and y into our original equation(s).

  (x -y +z)/2 = ((10 -z +2w) -(6 +0.4z +0.4w) +z)/2 = (2 -0.2z +0.8w)

  (y -z +2w)/3 = ((6 +0.4z +0.4w) -z +2w)/3 = (2 -0.2z +0.8w)

  (2x +z -10)/5 = (2(10 -z +2w) +z -10)/5 = (2 -0.2z +0.8w)

All of these expressions are identical, as they should be.

0.081 to the nearest hundredth

Answers

Answer:

0.08

Step-by-step explanation:

a 1 in the thousandths place is dropped in standard rounding to the nearest hundredth.

Answer:

0.08

Step-by-step explanation:

In 0.081, 0 is the tenth, 8 is the hundredth, and 1 is the thousandth. So as you want to approximate to the nearest hundredth, you have to look at the number behind 8 which is 1. And, 1 is less than 5, so you don't have to round up.

which among the following​

Answers

We have:

[tex]1-\frac{1}{3} >0[/tex]    ;   [tex]1- \frac{11}{17}>0[/tex]  ;    [tex]1-\frac{132}{157}>0[/tex]   ⇒ right

[tex]\frac{-1}{7}, \frac{-51}{107},\frac{-347}{949} <0[/tex]  ⇒ wrong

[tex]\frac{7}{5}, \frac{131}{47} ,\frac{945}{711} >1[/tex] ⇒ wrong

ANSWER: [tex]\frac{1}{3} ,\frac{11}{17} ,\frac{132}{157}[/tex]

ok done. Thank to me :>

HELPPPP ASAPPPPPPPPPPPP

Answers

Answer:

C

Step-by-step explanation:

Solve the equation. -10=2y

Answers

Answer:

y=-5

Step-by-step explanation:

-10/2=2y/2

-5=y

y=-5

Answer:

y = - 5

Step-by-step explanation:

You have yo divided the numbers

Cancel terms that are in both the numerator and denominator

Move the variable to the left

Write -37.75 as a mixed number.​

Answers

Answer:

[tex]-37\frac{3}{4}[/tex]

Step-by-step explanation:

0.75 is equivalent to three quarters, or (3/4).

3/4 would be the fraction. -37 would be the whole number.

[tex]-37.75 = \boxed{-37\frac{3}{4}}[/tex]

Hope this helps.

Answer:

- 37 3/4

Step-by-step explanation:

(3x(3)+9X(2)+27X)/3X

Answers

3x | 3x^3+9x^2+27x |x^2+3x+9x

- 3x^3

-------

9x^2

- 9x^2

---------

27x

- 27x

--------

0

Answer:

x^2 + 3x + 9x

Hope you could get an idea from here.

Doubt clarification - use comment section.

find the slope
a line that passes between (-5, 8) and (2,4)

Answers

Answer:

Step-by-step explanation:

formula : m=(y2-y1)/(x2-x1)

(4 - 8) / (2 - - 5)

-4 / 7

m = -4 / 7 = -0.57143

review the proof (not in order) of the identity tan(0/2) = + √1-cos(0)/1+cos(0)
which is the correct sequence of steps

Answers

Answer:

1-3-4-2-5

Step-by-step explanation:

[tex]tan\frac{\theta}{2}[/tex] <== Given

[tex]\frac{sin\frac{\theta}{2}}{cos\frac{\theta}{2}}[/tex] <== Step 1

[tex]\frac{\frac{\sqrt{1-cos\theta}}{2}}{\frac{\sqrt{1+cos\theta}}{2}}[/tex] <== Step 3

[tex]\frac{\sqrt{1-cos\theta}}{\sqrt{1+cos\theta}}[/tex] <== Step 2 (as a result of Step 4)

[tex]\pm\sqrt{\frac{1-cos\theta}{1+cos\theta} }[/tex] <== Step 5

The vertices of quadrilateral PQRS are listed.

P(3,7), Q(6,-2), R(0,-4), S(-3,5)
Which of the following is the strongest classification that identifies quadrilateral PQRS
A.
Quadrilateral PQRS is a square.
B.
Quadrilateral PQRS is a trapezoid.
C.
Quadrilateral PQRS is a rectangle.
D.
Quadrilateral PQRS is a parallelogram.

Answers

Answer:

It's C. for plato. It's a rectangle

Step-by-step explanation:

FILE BELOW

Answer:

its a rectangle .

Step-by-step explanation:


[tex]{ \color{darkred}{(2+√3)+(4-√3)}} = ?[/tex]
︎︎︎︎︎︎︎︎︎︎︎︎︎︎︎︎︎︎​

Answers

[tex](2 + \sqrt{3} ) + (4 - \sqrt{3} ) \\ = 2 + \sqrt{3} + 4 - \sqrt{3} \\ = 2 + 4 \\ = 6[/tex]

Answer:

6

Hope you could get an idea from here.

Doubt clarification - use comment section.

[tex]\huge \bf༆ Answer ༄[/tex]

Here's the solution ~

[tex] \sf(2 + \sqrt{3} ) + (4 - \sqrt{3}) [/tex]

[tex] \sf2 + \cancel {\sqrt{3} } + 4 - \cancel{\sqrt{3} }[/tex]

[tex] \sf6[/tex]

30 POINTS!!!! SOMEONE PLEASE HELP ME!!!

Answers

Answer:

  60 nickels

Step-by-step explanation:

When a ratio between coins is given, I like to consider the problem in terms of groups of coins. Here, each group would consist of 1 nickel and 0.20 quarters. The value of that group is

  5¢ +0.20×25¢ = 10¢

Then the number of groups is ...

  (total value)/(value of 1 group) = number of groups

  600¢/10¢ = 60

Since each group has 1 nickel, there are 60 nickels.

__

Check

60 nickels + 12 quarters = $3.00 +3.00 = $6.00

_____

Additional comment

If you want to see this with equations and variables, you can do this.

Let n and q represent the numbers of nickels and quarters, respectively. The given relations are ...

  0.05n +0.25q = 6.00

  q = 0.20n

Substituting for q in the first equation gives ...

  0.05n +(0.25)(0.20n) = 6.00

Simplifying gives ...

  0.10n = 6.00

  n = 6.00/0.10 = 60

B+8/2=6
How do I do this

Answers

divide 8/2 which is 4 so B+4=6 subtract 4 from both sides so b+4-4=6-4

so that means B=2 and that is ur answer

Answer:

B = 2.

Step-by-step explanation:

First work out 8/2. Okay so how many 2's go into 8? 4.

We now have B + 4 = 6.

Now that we've simplified it a bit we can do a reverse equation and turn it into subtraction.

Take the answer (6) and 4 and put them into a subtraction equation,

6 - 4. And simple subtraction should be easy so 6 - 4 = 2.

So B equals 2. Let's check it! 2 + 4 = 6. I think that sounds right so that will be the answer. B=2.

Hope that helps. x

What is 50 million + 32 hundred thousands + 41 hundred

Answers

Answer:

82041000

Step-by-step explanation:

50,000,000 + 32,000,000 + 41,000

The sum of three terms in AP is 15. If the first two terms are each decreased by 1 and the last is increased by 1 then the resulting terms are in GP. find the numbers.​

Answers

Answer:

3, 5, ,7 or 9, 5, 1

Step-by-step explanation:

Let the three terms in AP be a - d, a & a + d

where a = First term and d = Common difference.

Condition 1: sum of three terms in AP is 15.

a - d + a + a + d = 15

3a = 15

a = 15/3

a = 5

Condition 2: When first two terms are each decreased by 1 and the last is increased by 1 then new terms so obtained will be as follows:

a - d - 1, a - 1, a + d + 1

These terms are in G.P.

[tex] {(a - 1)}^{2} = (a - d - 1)(a + d + 1) \\ \\ {(5 - 1)}^{2} = (5 - d - 1)(5 + d + 1) \\ \\ {(4)}^{2} = (4 - d)(6 + d) \\ \\ 16 = 24 + 4d - 6d - {d}^{2} \\ \\ 0 = 8 - 2d - {d}^{2} \\ \\ {d}^{2} + 2d - 8 = 0 \\ \\ {d}^{2} + 4d - 2d - 8 = 0 \\ \\ d(d + 4) - 2(d + 4) = 0 \\ \\ (d + 4)(d - 2) = 0 \\ \\ d + 4 = 0 \: \: or \: \: d - 2 = 0 \\ \\ d = - 4 \: \: or \: \: d = 2 \\ \\ when \: d = - 4 \\ \\ a - d = 5 - ( - 4) = 9 \\ a = 5 \\ a + d = 5 - 4 = 1 \\ \\ when \: d = 2 \\ a - d = 5 - 2 = 3 \\ a = 5 \\ a + d = 5 + 2 = 7 \\ \\ thus \: three \: terms \: in \: AP \: are: \\9, \: 5, \: 1 \: \: or \: \: 3, \: 5, \: 7[/tex]

The triangle and rectangle have the same perimeter.find the value of x.

Answers

Answer:

[tex]x + 5 \: + \: x \: + 6 \: + x + 7 = 2x - 1 + x + 7 + x + 7 + 2x - 1[/tex]

[tex]3x + 18 = 6x + 12[/tex]

[tex]18 = 3x + 12[/tex]

[tex]6 = 3x[/tex]

[tex]x = 6 \div 3 = 2[/tex]

[tex]x = 2[/tex]

I hope this helps you !!

The base of a triangle is 4 ft more than the height. If the area is 30ft2, find the base and the height.

Answers

Answer:

Base = 10 ft. and the height = 6.

Step-by-step explanation:

Area of triangle = 1/2bh

base is 4 + h  ⇔  base = 4 + h

height = h

Using the formula for the area of triangle substitute into the formula the given facts.

A = 1/2bh

30 = 1/2(4 + h) (h)

30 = 1/2(4h + h²)     Multiply both sides by 2

60 = 4h + h²

-60 =           -60      Add -60 to both sides

0 = h²+ 4h -60        

(h + 10)(h - 6) = 0      Factor

h + 10 = 0    h - 6 =0

h = -10         h = 6

reject any negative number and use the positive answer for h.

So h = 6      and the base = 4 + 6 ; base = 10

One kilometre is about 0.62 miles. It is 12 kilometres from Noah's house to the
ice skating rink. About how many miles is it from Noah's house to the ice
skating rink?


u'll get extra points if u answer guys!! pls help!!!!!

Answers

Answer:

7.44miles

Step-by-step explanation:

1km = 0.62miles

12km will be ; 0.62 × 12

= 7.44miles

1 minute is equal to 60 seconds. How many seconds are in 3 minutes, 37 seconds?

Answers

Answer:

217 Seconds.

Step-by-step explanation:

The answer is 217 seconds because 60x3+37=217.

Find a polynomial f(x) of degree 4 that has the following zeros. -7, 0, 1, 6
leave your answer in factored form.

please help! its my exam study guide and i need to finish it! ​

Answers

[tex]\begin{cases} x=-7\implies &x+7=0\\ x=0\implies &x=0\\ x=1\implies &x-1=0\\ x=6\implies &x-6=0 \end{cases}\qquad \implies (x+7)(x)(x-1)(x-6)=\stackrel{y}{0} \\\\\\ (x+7)(x)\stackrel{using~\mathbb{FOIL}}{(x^2-7x+6)}=0\implies (x^2+7x)(x^2-7x+6)=0[/tex]

[tex]\begin{array}{llll} x^2-7x+6\\ \qquad \times ~x^2\\\cline{1-1} x^4-7x^3+6x^2 \end{array}\qquad +\qquad \begin{array}{llll} x^2-7x+6\\ \qquad \times ~7x\\\cline{1-1} 7x^3-49x^2+42x \end{array} \\\\\\ (x^4-7x^3+6x^2)+(7x^3-49x^2+42x)=0 \\\\[-0.35em] ~\dotfill\\\\ ~\hfill x^4-43x^2+42x=y~\hfill[/tex]

Aarón rides his bike away from home at a constant speed he stops at the park for a while before riding back home at a constant speed

Answers

Answer:

Step-by-step explanation: This is the answer

Determine the largest integer that makes 2 - 3(x+8) > 12 - x true.

Answers

Answer:

2

Step-by-step explanation:

Because if you add 1  to 8 you get 9 then subtract 9 by 7 then and your answer is

Xavier has 29 baseball
cards he'd like to share
with his 3 best friends.
Each friend gets an equal
number of cards. How
many baseball cards will
be left over?
Math

Answers

Answer:

2

Step-by-step explanation:

29 % 3 = 9

3x9 = 27

29 - 27 = 2

Other Questions
Who is Francois Mauriac and why, according to the Preface/Foreword, does he help Wieselget published? How does Mauriac describe Wiesel? Use textual evidence to support youranswer:I a group of 3 people are sharing chocolates each person wants 8 chocolates and each box has 4 chocolates 5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade. 108 is what percent of 72 The boys and the Darling children.... A rectangle with a width of 4.6 inches has an area of 23 inches squared. What is the length? The Later Middle Ages7Which of the following was the site of the only victory achieved by the Crusaders in the Second Crusade?OA. ConstantinopleOB. LisbonOC. EphesusODDamascus