Paola and Isidora are married; file a joint tax return; report modified AGI of $148,000; and have one dependent child, Dante. The couple paid $12,000 of tuition and $10,000 for room and board for Dante (a freshman). Dante is a full-time student and claimed as a dependent by Paola and Isidora. Determine the amount of the American Opportunity credit for 2020.

Answers

Answer 1

Answer:

$2,500

Explanation:

The computation of the amount is shown below;

In the case when the modified AGI upto $180,000 so it would be credit by $2,500 per eligible student

As we can see that in the given situation there is modified AGI that reported $148,000 so here the amount of  the American Opportunity credit for 2020 is $2,500 also we assume that the eligibility condition would be satisfied


Related Questions

A form of marketing in which a product or service is promoted by an individual that an audience looka up to is ___ marketing.

Answers

Answer:

Branding or Brand marketing or promotional marketing

Explanation:

In this form of marketing, a person known in the society or with huge followers on social media or other ways is made the brand ambassador for the product which needs promotion and hence the sale of that particular goods or service is boosted through marketing.

Suppose the Kalamazoo Brewing Company (KBC) currently sells its microbrews in a seven-state area: Illinoise, Indiana, Michigan, Minnesota, Mississippi, Ohio, and Wisconsin. The company's marketing department has collected data from its distributers in each state. This data consists of the quantity and price (per case) of microbrews sold in each state, as well as the average income (in thousands of dollars) of consumers living in various regions of each state. The data for each state are available via the link below--please note there are multiple tabs at the bottom of the spreadsheet, each refers to one of the seven states selling the Kalamazoo Brewing Company’s microbrews.
Excel Data File
Quantity Price Income
575 31.26 33.95
674 30.69 35.51
616 31.54 28.78
183 27.41 30.44
501 29.75 31.28
578 29.48 33.77
590 28.94 38.31
445 28.17 34.01
603 28.58 32.53
713 28.57 31.69
337 30.06 32.26
230 29.36 31.57
403 28.81 32.75
383 32.52 29.48
568 32.02 35.91
698 32.91 34.85
826 28.45 34.06
789 26.85 38.92
645 30.49 35.94
601 31.72 38.05
467 31.23 36.48
429 31.28 37.61
552 28.89 38.29
553 31.13 36.9
562 27.52 39.22
352 30.02 34.21
611 31.38 33.97
346 29.08 38.53
354 28.8 34.4
401 27.64 34.01
253 30.47 34.24
524 30.97 38.29
211 32.85 34.66
666 30.11 41.38
468 29.48 32.14
585 28.41 29.16
578 29.96 35.05
656 30.46 37.11
571 32.86 32.94
454 28.49 32.7
510 30.67 33.14
672 31.92 33.73
499 28.44 41.92
560 27.94 35.06
848 29.74 32.71
617 29.54 37.96
530 31.34 37.38
649 30.08 35.55
824 29.13 42.89
626 31.72 37.17
Assuming that the underlying demand relation is a linear function of price and income, use your spreadsheet program to obtain least squares estimates of Ohio’s demand for KBC microbrews. Instruction:
If the estimate is negative, enter a negative number (-) in the equation.

Answers

Answer:

The least squares estimates of Ohio’s demand for KBC microbrews is Quantity = 1.57Price + 14.00Income.

Explanation:

Note: See Sheet1 of the attached excel for the replication of the data given in the question and Sheet2 for the regression analysis output.

In the third table in the Sheet2, the second column is for the coefficients where, by rounding to 2 decimal places, we have:

Price = 1.57

Income = 14.00

Note: The intercept is 0 because a zero intercept was chosen in the analysi.

Based on the above, the least squares estimates of Ohio’s demand for KBC microbrews can be written as follows:

Quantity = 1.57Price + 14.00Income

To run the regression from Sheet1 in order to obtain the output in Sheet, follow his process:

Click the “Data” menu, and then the “Data Analysis” tab. From the new window, scroll down to find  and click on "Regression" and then click “OK”.

In the new window, click in the box of “Input Y Range”, and then select the column containing the Quantity data as the dependent variable. Also in the new window, click in the box of “Input X Range”, and then select the column containing the both Price and Income data as the independent variables. Also, select "Labels", "Confidence level (95%)", and "Constant is Zero". Then click "OK" to obtain the output in Sheet2.

Why is it important for everyone in an organization to have the opportunity to
contribute to the mission statement?
A. So it defines expected outcomes clearly
B. So that it will be accepted and used by employees
C. So employees know the organization's history
O D. So the organization can track progress toward meeting its goals

Answers

Answer: so that it will be accepted and used by employees

Explanation:

AP EX

What two factors are necessary for demand?

Answers

good or service and its availability in the market.

Answer:

Desire for a good or service and its availability in the market.

Journalize the following selected transactions for January. Journal entry explanations may be omitted.

Jan.
1 Received cash from the sale of common stock, $14,000.
2 Received cash for providing accounting services, $9,500.
3 Billed customers on account for providing services, $4,200.
4 Paid advertising expense, $700.
5 Received cash from customers on account, $2,500.
6 Paid dividends, $1,010.
7 Received telephone bill, $900.
8 Paid telephone bill, $900.

Answers

Answer and Explanation:

The journal entries are shown below:

On Jan 1

Cash $14,000

     To Capital owner $14,000

(being cash received)

On Jan 2

Cash $9,500

    To Account service revenue $9,500

(being cash received)

On Jan 3

Account receivable $4,200

       To Service revenue $4,200

(being service provided on account)

On Jan 4

Advertising expense $700

       To Cash $700

(being cash paid is recorded)

On Jan 5

Cash $2,500

       To Account receivable $2,500

(being cash received)

On Jan 6

Owner drawings $1,010

       To cash $1,010

(being cash paid is recorded)

On jan7

Telephone expense $900

      To Account payable   $900

(Being telephone bill received)

On Jan 8

Account payable $900

         To cash

(being cash paid is recorded)

Use the following information of VPI Co. to prepare a statement of cash flows for the year ended December 31 using the indirect method.
Cash balance at prior year-end $43,600 Gain on sale of machinery $2,900
Increase in inventory 8,600 Cash received from sale of
machinery 11,300
Depreciation expense 7,600 Increase in accounts payable 3,300
Cash received from issuing stock 11,600 Net income 59,000
Cash paid for dividends 4,600 Decrease in accounts
receivable 6,600

Answers

Answer:

                                                 VPI Co.

            Cashflow statement for the year ended December 31

                                                                               $

Operating activities                                            

Net income                                                         59,000

Add Depreciation                                                 7600

Less gain from sale of machinery                      (2900)

Increase in Inventory                                          (8,600)

Increase in accounts payable                              3,300

Decrease in accounts  receivable                        6,600

Cash flow from Operating activities                  65,000

Investing activities

Cash received from sale of  machinery              11,300

Financing activities

Cash paid for dividends                                      (4,600)

Net cashflow                                                        71,700

Cash balance at prior year-end                       43,600

Cash balance at current year-end                   114,300

Explanation:

The indirect method of cashflow statements starts with the cashflows from the operating activities to Financing and then investing activities.

An increase in an asset other than cash is a decrease in cash and vice versa. An increase in a liability is an increase in cash and vice versa. We add or subtract none cash items like depreciation, gain on asset disposal etc.

Fill in the blanks with the words given below.
a. Cancer
b. malignant tumor
c. benign tumor
d. metastasis
e. carcinoma
1. A________is a lump of abnormal cells that, although growing out of control, remains at its original site.
2. A________is an abnormally growing mass of cells that is actively spreading through the body.
3. A_________ is the spread of cancer cells from their site of origin to other sites in the body.
4. An individual with a malignant tumor is said to have_________
5. The most common type of cancer is a_______ this type always originates in tissues that line .

Answers

Answer:

1. Benign tumor.

2. Malignant tumor.

3. Metastasis.

4. Cancer

5. Carcinoma

Explanation:

A tissue can be defined as a group of cells that are structurally similar and in close proximity. Tissues are generally responsible for performing specific functions in living organisms such as humans, animals and plants. Therefore, tissues in living organisms function together as a unit.

A tumor can be defined as an abnormal mass of tissue formed when various body cells grow and divide more than its required or fail to when necessary (required). Thus, it usually degenerate into cancerous growths (cancer).

Some of the characteristics and features of tumors and cancer include the following;

1. A benign tumor is a lump of abnormal cells that, although growing out of control, remains at its original site.

2. A malignant tumor is an abnormally growing mass of cells that is actively spreading through the body.

3. A metastasis is the spread of cancer cells from their site of origin to other sites in the body.

4. An individual with a malignant tumor is said to have cancer.

5. The most common type of cancer is a carcinoma this type always originates in tissues that line.

The residents of Vegopia spend all of their income on cauliflower, broccoli, and carrots. In 2020, they spend a total of $200 for 100 heads of cauliflower, $75 for 50 bunches of broccoli, and $50 for 500 carrots. In 2021, they spend a total of $225 for 75 heads of cauliflower, $120 for 80 bunches of broccoli, and $100 for 500 carrots. (25 points) a. Calculate the price of one unit of each vegetable in each year. b. Using 2020 as the base year, calculate the CPI for each year. c. What is the inflation rate in 2021?

Answers

Answer:

siy-epdv-fwo join on meet

Cala Manufacturing purchases land for $281,000 as part of its plans to build a new plant. The company pays $35,400 to tear down an old building on the lot and $52,330 to fill and level the lot. It also pays construction costs $1,320,800 for the new building and $83,373 for lighting and paving a parking area. Prepare a single journal entry to record these costs incurred by Cala, all of which are paid in cash.

Answers

I really need these points thx a lot

Compute the current ratio for the fiscal years ending January 31, 2016, and February 1, 2015. a-2. Compute the quick ratio for the fiscal years ending January 31, 2016, and February 1, 2015. a-3. Compute the amount of working capital for the fiscal years ending January 31, 2016, and February 1, 2015. a-4. Compute the percentage change in working capital from the prior year for the fiscal years ending January 31, 2016, and February 1, 2015. a-5. Compute the percentage change in cash and cash equivalents from the prior year for the fiscal years ending January 31, 2016, and February 1, 2015.

Answers

Answer:

a1: January 31, 2016 Current ratio 1.357

February 1, 2015 1.358

a2: Quick ratio January 31, 2016 0.414

February 1, 2015 0.375

a3: Working capital January 31, 2016 4,467

February 1, 2015 4,033.

a4: % change in working capital in 2016 10.76%

% change in working capital in 2015 -10.97%

a5: % change in cash and cash equivalents in 2016 28.61%

% change in cash and cash equivalents in 2015 -10.68%

Explanation:

a1. Computation for Current ratio using this formula

Current ratio = current assets/current liabilities.

Let plug in the formula

Ratio for fiscal year ending January 31, 2016 = 16993/12526

Ratio for fiscal year ending January 31, 2016 = = 1.357

Ratio for the fiscal year ending February 1, 2015 = 15302/11269

Ratio for the fiscal year ending February 1, 2015 = 1.358

a2. Computation for Quick ratio using this formula

Quick ratio = (Total current assets – inventory – prepaid expenses)/current liabilities.

Let plug in the formula

Ratio for fiscal year ending January 31, 2016 = (16993-11809)/12526

Ratio for fiscal year ending January 31, 2016= 0.414

Ratio for the fiscal year ending February 1, 2015 = (15302-11079)/11269

Ratio for the fiscal year ending February 1, 2015 = 0.375

a3. Computation for Working capital using this formula

Working capital = current assets – current liabilities

Let plug in the formula

Working capital for fiscal year ending January 31, 2016 = 16993-12526

Working capital for fiscal year ending January 31, 2016= 4,467.

Working capital for the fiscal year ending February 1, 2015 = 15302-11269

Working capital for the fiscal year ending February 1, 2015= 4,033.

a4. Computation for % change in working capital in 2016 from prior year

% change in working capital in 2016 from prior year = (4467-4033)/4033

% change in working capital in 2016 from prior year = 10.76%

% change in working capital in 2015 from prior year = (4033-4530)/4530

% change in working capital in 2015 from prior year = -10.97%

a5. Computation for % change in cash and cash equivalents in 2016 from prior year

% change in cash and cash equivalents in 2016 from prior year= (2216-1723)/1723

% change in cash and cash equivalents in 2016 from prior year= 28.61%

% change in cash and cash equivalents in 2015 from prior year = (1723-1929)/1929

% change in cash and cash equivalents in 2015 from prior year= -10.68%

Frasquita acquired equipment from the manufacturer on 6/30/2021 and gave a noninterest-bearing note in exchange. Frasquita is obligated to pay $550,000 on 4/30/2022 to satisfy the obligation in full. If Frasquita accrued interest of $15,000 on the note in its 2021 year-end financial statements, what amount would it have recorded the equipment for on 6/30/2021

Answers

Answer:

$525,000

Explanation:

Calculation to determine what amount would it have recorded the equipment for on 6/30/2021

First step is to calculate the total interest for 10 months;

Based on the information given since the amount of $15,000 was the interest for 6 months in the year 2021 in which the note lasted for 10 months the total interest will be:

Total Interest = 10months/6months x $15,000 Total Interest=$25,000

Now let calculate 6/30/2021 Equipment

6/30/2021 Equipment=$550,000-$25,000

6/30/2021 Equipment=$525,000

Therefore what amount would it have recorded the equipment for on 6/30/2021 is $525,000

Five-A-Day, a company that produces and distributes organic vegetables for grocery stores, wants to market its vegetables in such a way that children will want to buy them. To accomplish this, the company creates an advertising campaign that features children dressed up in vegetable costumes attending a Halloween party and eating vegetables and dips as a snack. The company also packages cut up vegetables in grab-and-go containers in fun shapes and colorful designs to attract children's attention in the grocery store. Which marketing function does this scenario most closely described

Answers

Answer:

Selling

Explanation:

The marketing function that best describes this scenario is defined selling.

This is a strategy that the company uses when it wants to sell its product or service to a specific audience, in the case of the issue the audience is children. To this end, the company develops communication strategies that reach its target audience, such as developing advertising campaigns, using symbols and messages aligned with the tastes, desires and needs of its potential audience, to influence the choices, identification and process of purchase.

Allocating Liquidation Between Common Stockholders and Preferred Stockholders The Arcadia Company is liquidating. After paying off all of its creditors, the company has $2 million to distribute between its preferred stockholders and its common stockholders. The aggregate par value of the preferred stock is $1.8 million and the aggregate par value of its common stock is $4 million. How much of the remaining $2 million assets should be distributed to the preferred stockholders and how much should be distributed to the common stockholders

Answers

Answer and Explanation:

The computation is shown below:

The amount that should be distributed to the preferred stockholder would be equivalent to the aggregate par value of the preferred stock i.e. $1.8 million and the remaining value would be distributed to the common stockholders i.e.

= $2 million - $1.8 million

= $0.2 million

Hence, the same would be considered

Below are amounts found in the income statements of three companies.

Company Sales Revenue Cost of Goods Sold Operating Expenses Non-operating Expenses Income Tax Expense
Henry $12,000 $3,000 $4,000 $1,000 $1,000
Grace 15,000 10,000 6,000 3,000 0
James 20,000 12,000 2,000 0 2,000

Required:
a. For each company, calculate (a) gross profit, (b) operating income, (c) income before income taxes, and (d) net income.
b. For each company, calculate the gross profit ratio and indicate which company has the most favorable ratio.

Answers

Answer:

Explanation:

Below are amounts found in the income statements of three companies.

Adjusted Trial Balance
Account Title Debit Credit
Cash 1,500
Accounts Receivable 1,460
Prepaid Insurance 800
Supplies 900
Equipment 5,500
Accumulated Depreciation-Equipment 550
Accounts Payable 1,300
Wages Payable 760
Owner, Capital 6,550
Owner, Drawing 1,400
Service Revenue 8,900
Wages Expense 3,000
Rent Expense 1,500
Supplies Expense 900
Utilities Expense 600
Depreciation Expense—Equipment 500
18,060 18,060

Required:
From the above adjusted trial balance, journalize the necessary closing entries.

Answers

Answer:

a. Dr Service Revenue $8,900

Cr Income Summary $8,900

b. Dr Income Summary $6,500

Cr Wages Expense $3,000

Cr Rent Expense $1,500

Cr Supplies Expense $900

Cr Utilities Expense $600

Cr Depreciation Expense Equipment $500

c. Dr Income Summary $2,400

Cr Owner, Capital $2,400

d. Dr Owner, Capital $1,400

Cr Owner, Drawing $1,400

Explanation:

Preparation of the Closing Entries

a. Dr Service Revenue $8,900

Cr Income Summary $8,900

b. Dr Income Summary $6,500

($3,000+$1,500+$900+$600+$500)

Cr Wages Expense $3,000

Cr Rent Expense $1,500

Cr Supplies Expense $900

Cr Utilities Expense $600

Cr Depreciation Expense Equipment $500

c. Dr Income Summary $2,400

($8,900-$6,500)

Cr Owner, Capital $2,400

d. Dr Owner, Capital $1,400

Cr Owner, Drawing $1,400

Finlay, Inc., issued 10,000 shares of $51 par value preferred stock at $69 per share and 14,000 shares of no-par value common stock at $10 per share. The common stock has no stated value. All issuances were for cash. a. Prepare the journal entries to record the share issuances. b. Prepare the journal entry for the issuance of the common stock assuming that it had a stated value of $5 per share. c. Prepare the journal entry for the issuance of the common stock assuming that it had a par value of $1 per share.

Answers

Answer and Explanation:

The journal entries are shown below;

a. Cash  (10000 × $69) $690,000  

         To Preferred stock (10000 × $51) $510,000

         To Additional paid in capital $180,000

(Being issuance of the preferred stock is recorded)

Cash (14000 × $10) $140,000  

         To Common stock no par value  $140,000

(being issuance of the common stock is recorded)

b.  

Cash $140,000  

       To Common stock stated value (14000  ×$5) $70,000

       To Paid in capital in excess of stated value $70,000

(being issuance of the common stock is recorded)

c.  

Cash $140,000  

       To Common stock at par (14000 × $1)  $14,000

        To Paid in capital in excess of par $126000

(being issuance of the common stock is recorded)

Are monopolistically competitive firms efficient in​ long-run equilibrium? Monopolistically competitive firms A. are productively efficient because they produce at minimum average total cost and they are not allocatively efficient because they produce where price is equal to marginal revenue. B. are not productively efficient because they do not produce at minimum marginal cost and they are allocatively efficient because they produce where price is equal to marginal revenue. C. are not productively efficient because they do not produce at minimum marginal cost and they are allocatively efficient because they produce where marginal cost equals marginal revenue. D. are not productively efficient because they do not produce at minimum average total cost and they are not allocatively efficient because they produce where price is greater than marginal cost. E. are not productively efficient because they do not produce at minimum average total cost and they are not allocatively efficient because they produce where price is less than marginal cost.

Answers

Answer:

E)are not productively efficient because they do not produce at minimum average total cost and they are not allocatively efficient because they produce where price is greater than marginal cost.

Explanation:

Monopolistic competition can be regarded as imperfect competition whereby many producers that are competing against each other exist in the market, though they are selling products which can be differentiated from one another. Monopolistically competitive firms do

maximize their profit if their production is at a level where marginal costs as well as its marginal revenues equals. Hence, monopolistically competitive firms are not productively efficient because they do not produce at minimum average total cost and they are not allocatively efficient because they produce where price is greater than marginal cost.

How does implementing change affect strategic relationship management?
A. It upsets the balance between the needs of key positions.
ОО
B. There is very little impact on relationship management.
O C. Change doesn't impact internal relationships.
O D. It makes fewer resources available to satisfy stakeholders.

Answers

Answer:

A it upsets the balance

Explanation:

Answer:a

Explanation:

it upsets the balance

There are some excellent free personal finance apps available: Mint, GoodBudget, Mvelopes, BillGuard, PocketExpense, HomeBudget, and Expensify. After using Mint, you realize you need to pay off one of your high interest loans to reduce your interest expense. You decide to discount a $5,250, 345-day note at 3% to your bank at a discount rate of 4.5% on day 210. What are your proceeds

Answers

Answer: $5309.86

Explanation:

The proceeds will be calculated as:

Face value of note = $5250

Interest rate = 3%

Note tenure = 345

Number of days used = 360

Outstanding interest on note = $5250 × 3% × 345/360 = $150.94

Gross Proceeds = $5250 + $150.94 = $5400.94

Bank Discount rate = 4.5%

Discounting days = 210

Time if maturity left = 345 - 210 = 135

Discount rate for 135 days = 4.5%/360 × 135 = 1.69%

Discount value = $5400 × 1.69% = $91.14

Net proceeds after discount = $5400 - $91.14 = $5309.86

Exercise 11-7 Sell or Process Further Decisions [LO11-7] Dorsey Company manufactures three products from a common input in a joint processing operation. Joint processing costs up to the split-off point total $300,000 per quarter. For financial reporting purposes, the company allocates these costs to the joint products on the basis of their relative sales value at the split-off point. Unit selling prices and total output at the split-off point are as follows: Product Selling Price Quarterly Output A $ 10.00 per pound 11,000 pounds B $ 4.00 per pound 17,300 pounds C $ 16.00 per gallon 2,200 gallons Each product can be processed further after the split-off point. Additional processing requires no special facilities. The additional processing costs (per quarter) and unit selling prices after further processing are given below: Product Additional Processing Costs Selling Price A $ 48,250 $ 14.10 per pound B $ 68,055 $ 9.10 per pound C $ 23,780 $ 23.10 per gallon Required: 1. What is the financial advantage (disadvantage) of further processing each of the three products beyond the split-off point

Answers

Answer: See explanation

Explanation:

The financial advantage (disadvantage) of further processing each of the three products beyond the split-off point is calculated below:

For product A:

Selling price after further processing = $14.10

Selling price at the split-off point = $10.00

Incremental revenue per pound = $4.10

Total quarterly output in pounds = 11000

Total incremental revenue = 45100

Total incremental processing costs = 48250

Financial (disadvantage) = (3150)

For product B:

Selling price after further processing = $9.10

Selling price at the split-off point = $4.00

Incremental revenue per pound = $5.10

Total quarterly output in pounds = 17300

Total incremental revenue = 88230

Total incremental processing costs = 68055

Financial advantage = 20175

For product C:

Selling price after further processing = $23.10

Selling price at the split-off point = $16.00

Incremental revenue per pound = $7.10

Total quarterly output in pounds = 2200

Total incremental revenue = 15620

Total incremental processing costs = 23780

Financial (disadvantage) = (8160)

ando Company incurs a $10.00 per unit cost for Product A, which it currently manufactures and sells for $13.50 per unit. Instead of manufacturing and selling this product, the company can purchase it for $5.00 per unit and sell it for $11.90 per unit. If it does so, unit sales would remain unchanged and $5.00 of the $10.00 per unit costs of Product A would be eliminated. 1. Prepare Incremental cost analysis. Should the company continue to manufacture Product A or purchase it for resale

Answers

Answer and Explanation:

The preparation of the Incremental cost analysis is presented below:

Particulars           Product A          Purchase

Sales                    $13.50                $11.90

less: cost      

Avoidable cost       $5

Unavoidable cost   $5                    $5

Purchase cost                                 $5

Net income             $3.50              $1.90

Since the net income is higher in the manfufacture  so the company should continue with manfuacture the product A

Woolsey Corporation, a US company, expects to sell gods to a foreign customer at a price of 250,000 FC, with delivery and payment to be made on October 24, 2020. On July 24, 2020, Woolsey purchased a three-month put option for 250,000 FC and designated this option as a cash flow hedge of a forecasted foreign currency transaction expected to be completed in late October 2020. Assume that the transaction occurs on October 24, 2020 as expected. The option cost $4,000 and has a strike price of $2.17 per FC. The following spot exchange rates apply:

Answers

Answer:

$10,000 positive.

Explanation:

The computation of the amount that should be included is shown below:

= (Option strike price - spot rate) × purchased put options

= ($2.17 - $2.13) × 250,000

= $10,000

As the spot rate is less than the strike price so automatically there is a gain of $10,000:

"Which of the following is true? Airfreight A. has lower transporting rates than trucks. B. efficiently delivers all types of goods. C. serves many more locations than trucks. D. is best for goods that are heavy relative to their sales value, such as iron ore. E. can help reduce inventory costs."

Answers

Answer:

E. can help reduce inventory costs.

Explanation:

Airfreight can be defined as the transportation or movement of goods from one location to another through the air and use of shipping containers.

A shipping container refers to a metal container made from steel and having the ability or strength to withstand all external factors during shipment or storage of materials. It is an essential part of transportation of goods or materials from one location to another, thereby boosting trade between countries.

The various types of shipping containers are, dry storage container, open-side storage container, ISO Reefer container, flat rack container, tunnel container, open top container, double doors container, thermal containers, intermodal freight container etc.

An inventory cost can be defined as all costs such as carrying cost, stock out (shortage) cost and ordering cost that are associated with the procurement, holding (storage) and management (handling) of inventory.

Generally, airfreight can help to reduce the total logistics cost or inventory cost since it's faster, large and devoid of various impediments when compared with other forms of transportation.

Hence, the true statement about airfreight is that it can help reduce inventory costs.

Choose all of the items that are examples of fiscal policy.
a. There is an increase in income tax rates.
b. The Federal Reserve purchases bonds on the open market.
c. The estate tax is repealed.
d. Government increases military spending.
e. Public money is used to build a high-speed train that connects Los Angeles and Las Vegas.
f. The Federal Reserve increases the money supply by decreasing the reserve-ratio requirement.
g. To help domestic firms, government sets a quota on the number of goods that can be imported.

Answers

Answer:

A

C

D

E

Explanation:

fiscal policies are  steps taken by the government to stimulate the economy in order to cause the economy to move to full employment and price stability more quickly than it might otherwise.

fiscal policies can either be expansionary or contractionary

Expansionary fiscal policy is when the government increases the money supply in the economy either by increasing spending or cutting taxes.

Contractionary fiscal policy reduces money supply

tools of fiscal policy

Taxes

government spending

transfer payments

An effective performance management system is comprised of four steps: defining performance, monitoring and evaluating performance, reviewing performance, and providing consequences. This activity is important because, when administered properly, an effective performance management system is a powerful tool in your managerial repertoire for enhancing individual, group, and organizational effectiveness.
The goal of this exercise is to challenge your knowledge of the steps in the performance management process. cuook. Match each person to the step of performance management that his or her description best exemplifles.
1. Define Performance
2. Review Performance
3. Provide Consequences
4. Monitor and Evaluate Performance
Match eech of the options above to the items below.
A. Aileen and her supervisor discuss how the market is looking and how much of an increase sales she believes is realistic and attainable for this year.
B. Quentin has a discussion with his supervisor about how sales are going and whether or not it looks like he will make this year's budgeted sales figures.
C. While Vonda's sales are strong, they do not appear to be in line with what she and her supervisor anticipated, so they are meeting to discuss how she can boost her sales In time to meet her goals.
D. Yang receives his bonus check when he beats his sales goals by 10%.

Answers

Answer:

Marching items with Performance Management Steps:

Item    Performance Management Step

A.        Define Performance

B.        Review Performance

C.        Monitor and Evaluate Performance

D.        Provide Consequences

Explanation:

1. Define Performance:  This is the stage when performance objectives and goals are clearly defined and agreed upon.  The best performance goals are SMART goals, which are specific, measurable, attainable, realistic, and time-bound.

2. Review Performance: This is the stage when a goal is reviewed in the light of operational realities.

3. Provide Consequences: This stage issues the reward and punishment for either good or bad performance.

4. Monitor and Evaluate Performance:  This stage enables realistic goals to be reset amidst performance uncertainty.

The fictional global firm of Knickerbockers Socks established itself in the international trade industry ten years ago and has been an active participant with intra-industry trade in developed countries. Because of the way Knickerbockers operates, it can take advantage of economies of scale. What do economies of scale make possible for its sock customers

Answers

Answer: c. A large variety of sock styles and sizes at competitive prices.

Explanation:

Economies of scale refers to a scenario that arises with companies that operate on a certain scale that makes their cost per unit decrease as they produce more units of a good.

When this happens, such companies can offer more goods at cheaper prices because they have less costs to cover. Knickerboxers Socks has a economies of scale which allows it to produce a large variety of sock styles that it can sell at cheaper competitive prices.

Bengal Co. provides the following unit sales forecast for the next three months: July August September Sales units 5,800 6,500 6,360 The company wants to end each month with ending finished goods inventory equal to 30% of the next month's sales. Finished goods inventory on June 30 is 1,740 units. The budgeted production units for July are:

Answers

Answer:

Production= 6,010

Explanation:

Giving the following information:

July August

Sales units 5,800 6,500

Finished goods inventory on June 30 is 1,740 units.

To calculate the production for July, we need to use the following formula:

Production= sales + desired ending inventory - beginning inventory

Production= 5,800 + (6,500*0.3) - 1,740

Production= 6,010

Use the following information:
Windswept, Inc. 2017
Income Statement
($ in millions)
Net sales $10,200
Cost of goods sold 7,800
Depreciation 355
Earnings before interest and taxes $2,045
Interest paid 94 Taxable income $1,951
Taxes 585
Net income $ 1,366
Windswept, Inc. 2016 and 2017
Balance Sheets ($ in millions)
2016 2017 2016 2017
Cash $340 $360 Accounts payable $1,820 $1,680
Accounts rec. 1,050 950 Long-term debt 1,040 1,500
Inventory 1,820 1,740 Common stock 3,300 3,110
Total $3,210 $3,050 Retained earnings 620 870
Net fixed assets3,570 4,110
Total assets $6,780 $7,160 Total liab & equity $6,780 $7,160
What amount should be included in the financing section of the 2010 statement of cash flows for dividends paid?

Answers

Answer:

Windswept, Inc.

The amount that should be included in the financing section of the 2010 statement of cash flows for dividends paid is:

= $1,116

Explanation:

a) Data and Calculations:

Income Statement

($ in millions)

Net sales                                           $10,200

Cost of goods sold                               7,800

Gross profit                                        $2,400

Depreciation                                           355

Earnings before interest and taxes $2,045

Interest paid                                             94

Taxable income                                 $1,951

Taxes                                                     585

Net income                                      $ 1,366

Windswept, Inc.

Balance Sheets ($ in millions)

                                         2016     2017                                    2016     2017

Cash                                $340    $360  Accounts payable  $1,820  $1,680

Accounts receivable      1,050       950  Long-term debt       1,040     1,500

Inventory                        1,820     1,740   Common stock       3,300     3,110

Total                             $3,210 $3,050   Retained earnings     620      870

Net fixed assets            3,570     4,110

Total assets                $6,780  $7,160   Total liab & equity $6,780 $7,160

Dividends paid:

Retained earnings, 2016     $620

Net income for 2017            1,366

Total                                   $1,986

Retained earnings, 2017      (870)

Dividends paid =                 $1,116

Suppose 5 years have gone by and the company has to make a decision on how to move forward. It can either pay out all earnings as dividends without considering any growth opportunities or choose a growth strategy where the company will expand into new lines of business in global markets. If the management chooses this strategy, the payout ratio will be reduced down to 20% from 35%, and the company will be able to maintain a growth rate of 7% forever. Which strategy should the management choose to maximize shareholder value

Answers

Answer:

The management should choose the growth strategy.  It is always more rewarding and maximizes the shareholder value better than embarking on a payout strategy.

Explanation:

Choosing a payout strategy, which does not ensure growth, is not sustainable and does not maximize shareholder value.  Business expansion through market penetration, product development, market expansion, and diversification ensures business growth and maximizes shareholder wealth, enabling the company to pay out more in dividends stretched over longer streams.

The following transactions took place for Smart Solutions Inc. 2017.

a. July 1 Loaned $64,000 to an employee of the company and received back a one-year, 9 percent note.
b. Dec. 31 Accrued interest on the note. 2018.
c. July 1 Received interest on the note. (No interest has been recorded since December 31.)
d. July 1 Received principal on the note.

Required:
Prepare the journal entries that Smart Solutions Inc. would record for the above transactions.

Answers

Answer:

b

Explanation:

because that's the true answer

Other Questions
In 12 sentences, describe the relationship between heat and thermal insulators.(2 points)A baker uses oven mitts to open an oven, take a loaf of bread out, and place it on a plate. In 34 sentences, identify three examples of thermal energy transfer in the scenario.(4 points) why is yhe greatest amoug of eergy soted in a molecyle of atp The Nelson company has$1,212,500 in current assets and 485,000 in current liabilities. Its initial inventory level is $340,000 and it will raise funds as additional notes payable and use them to increase inventory. How much can Nelsons short term debt increase without pushing its current ratio below 2.0? do not around intermediate calculations. Round your answer to the nearest dollar. Bill Clinton reportedly was paid $15.0 million to write his book My Life. The book took three years to write. In the time he spent writing, Clinton could have been paid to make speeches. Given his popularity, assume that he could earn $8.4 million per year (paid at the end of the year) speaking instead of writing. Assume his cost of capital is 10.2% per year. a. What is the NPV of agreeing to write the book (ignoring any royalty payments)? b. Assume that, once the book is finished, it is expected to generate royalties of $4.7 million in the first year (paid at the end of the year) and these royalties are expected to decrease at a rate of 30% per year in perpetuity. What is the NPV of the book with the royalty payments? A semi-commercial test plant produced the following daily outputs in tonnes/ day: 1.3 2.5 1.8 1.4 3.2 1.9 1.3 2.8 1.1 1.7 1.4 3.0 1.6 1.2 2.3 2.9 1.1 1.7 2.0 1.4 a) Prepare a stem-and leaf display for these data. b) Prepare a box plot for these data. Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future?