PRACTICE ANOTHER A random sample of 100 people was taken. Eighty-two of the people in the sample favored Candidate A. We are interested in determining whether the proportion of the population in favor of Candidate A is significantly more than 79%. We know that the p-value is 0.2307. At the 0.05 level of significance, it can be concluded that the proportion of the population in favor of candidate A is

Answers

Answer 1

Answer:

0.2307 > 0.05, which means that we accept the null hypothesis, that is, that the population proportion in favor of candidate A is close to 0.79, that is, it is not significantly more than 0.79.

Step-by-step explanation:

We are interested in determining whether the proportion of the population in favor of Candidate A is significantly more than 79%.

This means that the null hypothesis is:

[tex]H_{0}: p = 0.79[/tex]

And the alternate hypothesis is:

[tex]H_{a}: p > 0.79[/tex]

We know that the p-value is 0.2307. At the 0.05 level of significance, it can be concluded that the proportion of the population in favor of candidate A is?

0.2307 > 0.05, which means that we accept the null hypothesis, that is, that the population proportion in favor of candidate A is close to 0.79, that is, it is not significantly more than 0.79.


Related Questions

100% of 80 is what number?
Select one:

160

80

8

100

Answers

Answer:

80

explanation:

100% means that its the whole of something so all of the said number

Answer:

In converting to percentage we multiply by 100%

100% of 80 =

80/100 x 100%

0.8 x 100 = 80

NB the 100% of any number is the number itself

Pudding has 120 calories in 2 ounces. How many calories are in 8 ounces of the pudding?

Answers

Answer:

272 calories.

Step-by-step explanation:

jus solved it.

Answer:

480

Step-by-step explanation:

The Frill family and the Smith family go to the movies.
The Frill family buys 6 adult tickets and 2 child tickets for $124.
The Smith family buys 3 adult tickets and 5 child tickets for $100.

Find the prize of an adult ticket and the prize of a child ticket.

Answers

Step-by-step explanation:

Let a be the price of 1 adult ticket.

Let c be the price of 1 child ticket.

given,

[tex]6a + 2c = 124[/tex]

as equation 1,

and

[tex]3a + 5c = 100[/tex]

as equation 2.

Now we will solve for a and c using elimination method of simultaneous equations.

Now we multiply equation 2 by 2 to eliminate a and solve for c.

[tex]3a \times 2 + 5c \times 2 = 100 \times 2 \\ 6a + 10c = 200[/tex]

This new equation will be equation 3.

Now we will use equation 1 - equation 3 to eliminate a and solve for c.

[tex](6a - 6a) + (2c - 10c) = 124 - 200 \\ 0 + ( - 8c) = - 76 \\ - 8c = - 76 \\ c = - 76 \div - 8 \\ = 9.5[/tex]

Now substitute c into equation 2.

[tex]3a + 5(9.5) = 100 \\ 3a + 47.5 = 100 \\ 3a = 100 - 47.5 \\ 3a = 52.5 \\ a = 52.5 \div 3 \\ = 17.5[/tex]

Therefore one adult ticket will cost $17.50 and one child ticket will cost $9.50.

BRAINLIEST FOR CORRECT ANSWER, IM FAILING SCHOOL AND NEED HELP ASAP. EVEN OFFICIAL HELP COUNTS

Answers

Answer:

x=76

Step-by-step explanation:

The two marked angles are alternate angles, which means they're equal.

Answer

76%

Step-by-step explanation:

I think its defiantly not 104 because its smaller than 90% and not 41% because that's to small same with 67% so it is 76%

In the figure, two poles are 25 m and 35 m high. A cable 23 m long Joins the tops of the poles. Find the distance between the poles.​

Answers

Answer: 20.71 m

Step-by-step explanation:

Given

the length of the poles are 25m and 35 m

The length of the cable is 23 m

Suppose the distance between them is x

From the figure, apply Pythagoras theorem

[tex]\Rightarrow 23^=x^2+10^2\\\Rightarrow 529-100=x^2\\\Rightarrow x^2=429\\\\\Rightarrow x=\sqrt{429}=20.71\ m[/tex]

Distance between Poles is 20.71 m

WITH STEPS PLEASEE..

Answers

Answer:

16+3y=31

3y=31-16

3y=15

y=15/3

y=5

check.

16+3×5

=16+15

=31

The answer for this is Y=5

Oil prices are projected to increase by 125% by next August. A quart of oil currently costs $1.25. What is the projected cost of a gallon of oil next August? Round your answer to the nearest hundredth.

Answers

Answer:$2.81

Step-by-step explanation:

1.25 is 100% of the price

125% + 100% = 225%

x = price by august

x = 225% (1.25)

225% = 2.25

2.25(1.25) = 2.8125 ≈ $2.81

Another way to see it:

=

225(1.25) / 100 = 2.8125

Plss answer this will give brainliest 5 stars and a thx
IVE BEEN ASKING FOR 2 DAYS :( OVERDUE

Answers

Answer: -10

Step-by-step explanation:

A negative number divided by a positive number is always going to be negative

Answer:

-10

Step-by-step explanation:

Because a negative number divided by a positive number is a negative number.

The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.

What is the residual value when the price of jeans is $28.00?
A)−9.37
B)−1.13
C)1.13
D)9.37

Answers

Answer:

1.13

Step-by-step explanation:

The residual value when the price of jeans is $28.00 is -15.13

How to determine the residual?

The equation of the line of best fit is:

y= -1.75x+92.13

When the price of jeans is $28.00, we have:

y= -1.75*28+92.13

Evaluate

y= 43.13

The residual value is then calculated as:

Residual = Actual - Observed

This gives

Residual = 28.00 - 43.13

Evaluate the difference

Residual = -15.13

Hence, the residual value when the price of jeans is $28.00 is -15.13

Read more about residual at:

https://brainly.com/question/16060586

A Customer Telephone Center receives 1,200 calls in a 24-hour period. Of these calls, 75% occur between 9:30 a.m. and 3:30 p.m., and calls are evenly distributed during this time. If each person handles 10 calls an hour, how many people are needed to handle calls during these hours

Answers

Divide Total time into two Time Periods. A regular Demand and a High Demand Time Period. Since 75% of the 1,200 calls occur between 9:30 am and 3:30 pm. We multiply .75 x 1,200 to get 900. We get an average of 900 calls every day between the hours of 9:30 am and 3:30 pm – Our net time for this time period is 6 hours.

Therefore, 6 Hours/900 becomes our quotient

Again, since the denominator is larger we invert it to 900 calls/6 Hours

To get a demand of 150 calls per hour.

We need to be able to handle 150 calls per hour.

So how Many Call Representatives are needed?

Again, our historical data tells us that each person can handle 10 calls an hour.

Therefore 150 calls per hour /10 Minutes = 15 Customer Service Representatives are needed during Peak Time!

Now, Subtract the Peak Hours from the 21 Hours Net Time Per day, gives us 15 Non-Peak hours we have to staff.

Work out
44.09
% of
78.76
cm

Answers

Answer:

34.72

Step-by-step explanation:

44.09/100 × 78.76

=34.72

St. Francis Bank pays 4% interest, compounded daily, from the date of deposit to the date of withdrawal. The daily interest rate (to the nearest milionths' place)
for October 14 (92 days in the quarter) on this account is:
0.000109.
0.000112
0.000098.

Answers

Answer:

The daily interest rate on this account = 0.000109

Step-by-step explanation:

Given that,

Interest rate = 4% compounded daily

i.e

Interest is 4% per annum and it is compounded daily.

Now,

We know , 1 year = 365 days

and 1 year interest rate = 4% = [tex]\frac{4}{100}[/tex] = 0.04

So,

The daily interest rate = [tex]\frac{0.04}{365}[/tex] = 0.000109

∴ we get

The daily interest rate on this account = 0.000109

"An education researcher recorded the number of books students read over the last year and the number of vocabulary words that students defined correctly on a test of 100 vocabulary words. The resulting data were used to conduct a hypothesis test to investigate whether there is a positive linear relationship between the number of books read and the number of vocabulary words defined correctly. What are the correct hypotheses for the test?"

Answers

Answer:

B

Step-by-step explanation:

Please helppp why is he right or wrong!!

Answers

Answer:

We cannot agree with Andre because x = 3.

Step-by-step explanation:

Assuming the diagram is a weighing scale which can also be represented as an equation having two sides that is balanced. We can express the situation as follows using equation:

x + 2 = 5

Solve for x

x + 2 - 2 = 5 - 2 (subtraction property of equality)

x = 3

If you plug in the value of x on the diagram given, the scale becomes balance on each side.

Therefore, x = 3. Andre is wrong and we cannot agree with Andre.

please help me on this its reading​

Answers

The answer is C to be informed about a new topic.

Answer:

C.

Step-by-step explanation:

C. be informed about a new topic

An agricultural researcher is interested in estimating the mean length of the growing season in a region. Treating the last 10 years as a simple random​ sample, he obtains the following​ data, which represent the number of days of the growing season. What is the point estimate of the population mean number of days of the growing​ season? 151 164 146 143 167 188 190 180 170 148 The point estimate is nothing.

Answers

Answer:

The point estimate of the population mean is 164.7

Step-by-step explanation:

Given

[tex]n =10[/tex]

[tex]Data: 151\ 164\ 146\ 143\ 167\ 188\ 190\ 180\ 170\ 148[/tex]

Required

The point estimate of the mean

To do this, we simply calculate the sample mean using;

[tex]\bar x =\frac{\sum x}{n}[/tex]

[tex]\bar x =\frac{151 +164 +146 +143 +167 +188 +190 +180+170 +148}{10}[/tex]

[tex]\bar x =\frac{1647}{10}[/tex]

[tex]\bar x =164.7[/tex]

Which set of ordered pairs represents a function?
A {(22, 5), (23, 10), (22, 7), (23, 5)}
B {(22, 5), (26, 10), (23, 7), (23, 5)}
C {(22, 10), (23, 10), (24, 7), (25, 5)}
D {(24, 10), (23, 6), (22, 7), (24, 5)

Answers

Answer:

D

Step-by-step explanation:

the company is it a big company with you in my neighborhood that is a lot more expensive and more expensive to

Can someone please help me out pleaseeeee !!!!!

Answers

Answer:

Step-by-step explanation:

0: -2

1: -4

2: -6

What expression is equivalent to
16+2*36

Answers

Answer: It looks like this expression is 16+2 times 36, so the answer is 18 times 36 also 88, they are both equivalent

(x +y )(x -y), if x = -3, y=-5
PLS NO FILES OR I AM REPORTING YOU

Answers

Answer:

-16

Step-by-step explanation:

(X + Y)

= (-3 + -5)

= -8

(X - Y)

= (-3 - -5)

= 2

Because  they're still in brackets in this form:

(-8) (2)

You multiply them both and you'll get the answer:

-16

hope this helped!

What is the slope of the line through? (-4, 2) and (3, -3)?

Answers

Answer:

c. -5/7

Step-by-step explanation:

Yesterday I went to buy some ice cream because it was on sale for $0.73. While I was there I also wanted to buy some sprinkles to put on top and they were only $0.15! What a bargain!!!! Since everything was so cheap, I also thought that I might want to buy a water bottle that was $2. When I went up to the cashier, they told me that I owed $9. EXCUSE ME?!? I said to them “I thought you all had a sale today, why am I paying $9?.”
how much you should’ve been charged

Answers

Given statement Sale Pricing Confusion solution is :- You should have been charged $2.88, not $9.

Let's break down the costs:

Ice Cream: $0.73

Sprinkles: $0.15

Water bottle: $2.00

The total cost of these three items would be:

$0.73 + $0.15 + $2.00 = $2.88

According to the prices you mentioned, you should have been charged $2.88, not $9. If the cashier told you that you owed $9, it's possible that there was an error in their calculations or that they included other items in your bill. It's best to clarify the discrepancy with the cashier and ask for an explanation or correction.

For such more questions on Sale Pricing Confusion

https://brainly.com/question/26171735

#SPJ8

h(a) = 3 - 2a ^ 2
h(- 3) =

Answers

Answer: -15

Step-by-step explanation:

First, calculate exponents.

-3 * -3 is 9.

Then multiply 2 and 9 which is 18.

3-18 is -15.

The formula for the volume of a cone is V =
3
bah
Solve V =
on for b, the base of the cone.

Answers

Answer:

oh thats easy thats 7

Step-by-step explanation:

i guess

PLEASE HELP! IM LIKE STUCK AND I NEED HELP! YOU'LL GET 50 POINTS !!!!

Answers

I got it hold up I will use my app

Answer:

5m + 9n + 46

Step-by-step explanation:

5m +10 +9n +36

(i did that by distributing from parenthesis)

5m + 9n + 46

(i just simplified by adding 10 and 36)

Researches conducted a study to determine whether magnets are effective

Answers

What is the question though

someone please help me! show work if you can please!

Answers

Answer:

a. [tex]12\sqrt{3}[/tex]

b. [tex]144\sqrt{3}[/tex]

c. [tex]24+24\sqrt{3}[/tex]

Step-by-step explanation:

This rectangle is made up of two 30-60-90 right triangles, which have special properties that are worth memorizing for the future. Please see the attached picture.

Using this information, we can deduce that the top and bottom sides are equal to [tex]12\sqrt{3}[/tex].

From the properties of a rectangle we know that the right side is 12.

The diagonal is equal to [tex]12*2=24[/tex].

We can find the area by doing [tex]{12*12\sqrt{3}=144\sqrt{3}[/tex],

And the perimeter is equal to [tex]12+12+12\sqrt{3}+12\sqrt{3} =24+24\sqrt{3}[/tex]

PLS HELP ME OUT GUYS PLS PLS PLS PLS

Answers

the 1st, 2nd, and 3rd are correct

i am stuck on these two, please help if you can. thank you :)

Answers

Answer:

23) x= [tex]\frac{27}{8}[/tex]

24) x= [tex]8\sqrt{3}[/tex]

Step-by-step explanation:

URGENT WILL GIVE BRAINLIEST

Answers

Answer:

40

Step-by-step explanation:

Other Questions
A semi-commercial test plant produced the following daily outputs in tonnes/ day: 1.3 2.5 1.8 1.4 3.2 1.9 1.3 2.8 1.1 1.7 1.4 3.0 1.6 1.2 2.3 2.9 1.1 1.7 2.0 1.4 a) Prepare a stem-and leaf display for these data. b) Prepare a box plot for these data. Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment? Prepare a 5 mins PPT presentations with voice overs to the board members on the financial strength of Cool-Ice especially in financing its long-term loan. find the two x-intercepts of the function f and show that f '(x) = 0 at some point between the two x-intercepts. f(x) = x x 2 There are 20 problems in a mathematics competition. The scores of each problem are allocated in the following ways: 3 marks will be given for a correct answer. I mark will be deducted from a wrong answer and O marks will be given for a blank answer. Find the minimum number of candidate(S) to ensure that 2 candidates will have the same scores in the competition.