raise the product of 36 and 9 to the power of the sum of 2 and 4

Answers

Answer 1

Answer:

1.15683 1381 * 10^15

Step-by-step explanation:

To get the answer, first, get the product of 36 and 9

This can be obtained by multiplying 36 with 9

36 * 9 = 324

We then raise 324 to the power of the sum of 2 and 4

The sum of 2 and 4 is gotten by adding 2 to 4

So,

2 + 4=6

Therefore, 324 raised to the power of 6

= 1.15683 1381 * 10^15


Related Questions

The weights of broilers (commercially raised chickens) are approximately normally distributed with mean 1395 grams and standard deviation 200 grams. Use the TI-84 Plus calculator to answer the following. (a) What proportion of broilers weigh between 1160 and 1250 grams?(b) What is the probability that a randomly selected broiler weighs more than 1510 grams? (c) Is it unusual for a broiler to weigh more than 1610 grams? Round the answers to at least four decimal places.

Answers

Answer:

a) 0.0977

b) 0.3507

c) No it is not unusual for a broiler to weigh more than 1610 grams

Step-by-step explanation:

Mean = 1395 grams

Standard deviation = 200 grams. Use the TI-84 Plus calculator to answer the following.

We solve using z score formula

z = (x-μ)/σ, where x is the raw score, μ is the population mean, and σ is the population standard deviation.

(a) What proportion of broilers weigh between 1160 and 1250 grams?

For x = 1160

z = 1160 - 1395/300

= -0.78333

Probability value from Z-Table:

P(x = 1160) = 0.21672

For x = 1250 grams

z = 1250 - 1395/300

z = -0.48333

Probability value from Z-Table:

P(x = 1250) = 0.31443

The proportion of broilers weigh between 1160 and 1250 grams is

0.31443 - 0.21672

= 0.09771

≈ 0.0977

(b) What is the probability that a randomly selected broiler weighs more than 1510 grams?

For x = 1510

= z = 1510 - 1395/300

z = 0.38333

Probability value from Z-Table:

P(x<1510) = 0.64926

P(x>1510) = 1 - P(x<1510) = 0.35074

Approximately = 0.3507

(c) Is it unusual for a broiler to weigh more than 1610 grams?

For x = 1610

= z = 1610 - 1395/300

z = 0.71667

Probability value from Z-Table:

P(x<1610) = 0.76321

P(x>1610) = 1 - P(x<1610) = 0.23679

No it is not unusual for a broiler to weigh more than 1610 grams

Jean paid $26 for a pair of pants and $19 for a blouse. How much more did she pay for the pants than for the blouse?

Answers

Answer:

$5 More

Step-by-step explanation:

$26 - $19 = $5

Answer:

She paid $7 more

2. What is the difference if 0.915 is taken from 2.31?
A. 1.395
B. 3.225
C. 2.395
D.4.126

Answers

A. 1.395
2.31 - 0.915 = 1.395

Can someone answer number 1? It’s a picture on top

Answers

I think this is the correct answer
0.3085
The answer is 0.3085 I think
When I calculated it that’s the answer it gave me

Which of the equations below could be the equation of this parabola?
(0,0)
Vertex
5
O A. x = 1 / ²
O B. - *
O c. y - 1²
D. x - - 1 / 2
0

Answers

The answer is D.
I hope is correct, I did my best!!!

Based on the graph, an equation which could be the equation of this parabola is x = -5y².

How to find the equation of a parabola.

Mathematically, the general equation of a parabola is given by:

[tex]y = a(x-h)^2 + k \\\\ x= a(y-k)^2 +h[/tex]

Where:

h and k represents the vertex.

Also, the standard equation of a regular parabola is given by:

y = x²/4a

Note: The vertex for this parabola is at the origin (0, 0).

Based on the graph, an equation which could be the equation of this parabola is x = -5y².

Read more on parabola here: https://brainly.com/question/25651698

find the sum of 301+73+27 , mentally, using the associative property of addition. Show how you can use the property to group two of the addends. Explain how you found the sum.

Answers

Answer:

401

Step-by-step explanation:

301 + 73 + 27

Using the correct order of operations, you would start by adding 301 to 73. Then you'd add 27 to that sum.

Using the associative property of addition, you change the grouping to add 73 and 27 first since that equals 100, and it's easy to add 100 to 301 mentally.

301 + 73 + 27 =

= 301 + (73 + 27)

= 301 + 100

= 410

!!!Plz help!!!Which notation shows that Pis a function of X?
A. Pox
B. P(x)
C. x.P
O D. x(P)

Answers

Answer:

the answer is that B .P(X)

A class consists of 10 male students and 30 female students. If one student is randomly selected from the class, what is the probability of selecting a male student?a. 10/30.
b. 10/40.
c. 1/10.
d. 1/40.

Answers

Answer:

a=10/30

Step-by-step explanation:

because you can simplify it to 2/15

I need help with this please

Answers

Answer: In math, especially when learning algebra and geometry, you are more likely to a lot of deductive reasoning. That is the process of using theorems, properties of numbers and other recognized rules and procedures to solve equations, to prove geometrical constructions, congruence of angles, etc. Deductive reasoning is the foundation of most of that kind of math, so it is more important when learning and applying the principles and theorems.

Inductive reasoning involves taking specific observations and known facts and using them to make predictions and generalizations. You are more likely to use inductive reasoning when working with statistics and probability.

So both are important at some point, but it may be more important to learn deductive reasoning at first.

At what angle does a diffraction grating produce a second-order maximum for light having a first-order maximum at 20.0 degrees?

Answers

Answer:

At 43.2°.

Step-by-step explanation:

To find the angle we need to use the following equation:

[tex] d*sin(\theta) = m\lambda [/tex]

Where:

d: is the separation of the grating

m: is the order of the maximum

λ: is the wavelength

θ: is the angle              

At the first-order maximum (m=1) at 20.0 degrees we have:

[tex] \frac{\lambda}{d} = \frac{sin(\theta)}{m} = \frac{sin(20.0)}{1} = 0.342 [/tex]

Now, to produce a second-order maximum (m=2) the angle must be:

[tex] sin(\theta) = \frac{\lambda}{d}*m [/tex]

[tex] \theta = arcsin(\frac{\lambda}{d}*m) = arcsin(0.342*2) = 43.2 ^{\circ} [/tex]

Therefore, the diffraction grating will produce a second-order maximum for the light at 43.2°.    

I hope it helps you!                                                        

Help ASAP Find the measure of 2.

21
69
111

Answers

Answer:

69°

Step-by-step explanation:

m∠1 + 111° = 180° ⇒ m∠1 = 69°

m∠1 = m∠2 = 69°

I WILL GIVE YOU 20 POINTS AND THE BRAINLYEST
all of the points in the picture are on the same line.

Find the slope on the like exain or show your reasoning

write and equation for the line.

find the values for A and B. Explain your reasoning. ​

Answers

Answer/Step-by-step explanation:

✍️Slope of the line using two points, (2, 2) and (6, 10),

[tex] slope (m) = \frac{y_2 - y_1}{x_2 - x_1} = \frac{10 - 2}{6 - 2} = \frac{8}{4} = 2 [/tex]

✍️To find the equation of the line in slope-intercept form, we need to find the y-intercept (b).

Substitute x = 2, y = 2, and m = 2 in y = mx + b, and solve for b.

2 = (2)(2) + b

2 = 4 + b

2 - 4 = b

-2 = b

b = -2

Substitute m = 2 and b = -2 in y = mx + b.

✅The equation would be:

[tex] y = 2x + (-2) [/tex]

[tex] y = 2x - 2 [/tex]

✍️To find the value of a, plug in (a, 8) as (x, y) into the equation of the line.

[tex] 8 = 2(a) - 2 [/tex]

[tex] 8 = 2a - 2 [/tex]

Add 2 to both sides

[tex] 8 + 2 = 2a [/tex]

[tex] 10 = 2a [/tex]

Divide both sides by 2

[tex] \frac{10}{2} = a [/tex]

[tex] 5 = a [/tex]

a = 5

✍️To find the value of b, plug in (4, b) as (x, y) into the equation of the line.

[tex] b = 2(4) - 2 [/tex]

[tex] b = 8 - 2 [/tex]

[tex] b = 6 [/tex]

Sidra is building a birdhouse. She drills a hole with a drill bit and tries to find a corresponding screw. The 1/4 inch screw is too big, and the 1/8 inch screw is too small. Which of the following could be the size of the drill bit Sidra used? 1/2 inch, 3/16 inch, 5/16 inch, 4/32 inch, or 8/32 inch

Answers

3/16
1/8 < x < 1/4
1/2 > 1/4 so 1/2 is wrong
If we multiply both top and bottom of 1/4 by 4 we get 4/16 which is less than 5/16 so 5/16 is wrong
4/32 can be simplified to 1/8 which is given to be too small so 4/32 is wrong
8/32 can be simplified to 1/4 which is given to be too big so 8/32 is wrong

A package of 6 pairs of insulated gloves cost $45.54. What is the unit price of the pairs of gloves?
ASAP PLEASE

Answers

Answer:

7.59 dollars is the unit price

Step-by-step explanation:

Math HELP PLEASEE URGENT NOWWWWWW MATH!!!!

Answers

Answer:

A

Step-by-step explanation:

Answer is the first choice. you can tell by the notation.

Answer:

is A

Step-by-step explanation:

Because i now how do this

Calleigh puts 5 nickels into an empty hat. She
wants to add enough pennies so that the probabil-
ity of drawing a nickel at random from the hat is 1/6
How many pennies should she put in?

Answers

Calleigh should put in 30 pennies

Use differentials to approximate the value of the expression. Compare your answer with that of a calculator. (Round your answers to four decimal places.) (8.99)3 using differentials

Answers

Answer:

726.572699

Step-by-step explanation:

According to differentials

(x+Δx)³ = x³ + 3x²Δx + 3x(Δx)² + (Δx)³ (Using binomial expansion)

Using this formula to solve (8.99)³, this can also be written as;

(8.99)³ =  (9-0.01)³ where

x = 9

Δx = -0.01

Substitute this vales into the differential expression above

(9+(-0.01))³ = 9³ + 3(9)²(-0.01) + 3(9)(-0.01)² + (-0.01)³

(9+(-0.01))³ = 729 + (243)(-0.01) + 27(0.0001) + (-0.000001)

(9+(-0.01))³ = 729-2.43+0.0027-0.000001

(9+(-0.01))³ = 729-2.43+0.0027-0.000001

(9+(-0.01))³  = 726.572699

Hence 8.99³ = 726.572699 (Using differential)

Using calculator;

8.99³ = 726.572699

Write an equation for the line in the given form.
Contains the points (2,8) and (3, 11); slope-intercept form

Answers

Answer:

y = 3x + 2

Step-by-step explanation:

y=mx+b is slope intercept form

to find slope (m):

y2-y1/x2-x1 = 11-8/3-2 = 3

your slope is 3 so 3x

to find the y-intercept (b):

plug in y and x from either of the two points

(2,8)... 8=3(2)+b and solve for b which equals 2

so final equation is y=3x+2

If triangle ABC is equilateral, and side AC is 7m long, how long is side BC?

Answers

Answer:

7m

Step-by-step explanation:

In an equilateral triangle all the sides and angles are the same

I believe the answer is 8m

Your last doctor visit cost $105 health insurance through your employer pay $84 and you pay the remaining $21 what percentage of the cost if you pay

Answers

Answer:20% percentage of the cost you pay .

Step-by-step explanation:

Formula

As given

Your last doctor’s visit cost $105.

Health insurance through your employer paid $84, and you paid the remaining $21.

Part value = $21

Total value = $105

Put all the values in the formula

Percentage = 20%

Therefore the 20% percentage of the cost you pay .

Answer: 20%

Step-by-step explanation:

the length of a rectangular sign is 5 times its width. If the sign's perimeter is 24inches, what is the signs area

Answers

Answer:

20 square inches

Step-by-step explanation:

Set width of sign to x.

Set length of sign to y.

5x=y

2(x+y)=24 inches

2(x+5x)=24 inches

12x=24 inches

width = 2 inches

length = 10 inches

Area = 20 square inches

PLEASE GIVE BRAINLIEST

The area of the rectangular sign will be 20 square inches

What is the area of the rectangle?

The space occupied by any two-dimensional figure in a plane is called the area. The space occupied by the rectangle in a two-dimensional plane is called the area of the rectangle.

Given that the length of a rectangular sign is 5 times its width. If the sign's perimeter is 24 inches.

The area of the rectangle will be calculated as follows:-

5x = y

2(x+y)=24 inches

2(x+5x)=24 inches

12x=24 inches

The area of the rectangle:-

width = 2 inches

length = 10 inches

Area = 20 square inches

Therefore, the area of the rectangular sign will be 20 square inches.

To know more about the area follow

https://brainly.com/question/25292087

#SPJ5

What is the horizontal distance from the origin to the point 2,9

Answers

Answer:

2

Step-by-step explanation:

The x-coordinate of point (2, 9) is 2.

The distance from 0 to 2 on a number line is 2.

Answer: 2

please help! due in less than 20 minutes!

Answers

Answer:

1. -8 feet= 8 feet

-2 feet= 2 feet

2.  Jordin’s balance is a debt of MORE than 27$

3. Dinah had the greatest DECREASE in weight, with losing 1.4 pounds.

Hope this helps hun! Good Luck!

Mixed in a drawer are 2 blue​ socks, 8 white​ socks, and 6 gray socks. You pull out two​ socks, one at a​ time, without looking. Find the probability of getting 2 socks of the same color.

Answers

Answer:

6/16

Step-by-step explanation:

Write them out bb wwwwwwww gggggg

there are 16 in total so it would be 6/16 because of each color like bb ww gg thats 6 out of 16

The probability of getting 2 socks of the same color is 1/3.

What is the probability?

Probability refers to a possibility that deals with the occurrence of random events.

The probability of all the events occurring need to be 1.

In the drawer,

Number of blue socks = 2

Number of white socks = 8

Number of gray socks = 6

Total number of socks  = 2 + 8 + 6 = 16

The Total ways to select 2 socks form 16 socks is 120.

The Total ways to select 2 socks of the same color is

T = Possible ways of (2 blue + 2 white +2 gray) socks = 40

The probability of getting 2 socks of the same color is

= 40/120

= 1/3

Therefore, the probability of getting 2 socks of the same color is 1/3.

Learn more about probability here;

https://brainly.com/question/11234923

#SPJ6

Imena earned $261 last week. If she worked 18 hours and earned the same amount each hour, how much was she paid per hour?

Answers

The answer to your question is $14.50 a hour

The amount paid to Imena per hour will be $14.5

What is an expression?

The mathematical expression combines numerical variables and operations denoted by addition, subtraction, multiplication, and division signs.

Mathematical symbols can be used to represent numbers (constants), variables, operations, functions, brackets, punctuation, and grouping. They can also denote the logical syntax's operation order and other properties.

Given that Imena earned $261 last week. She worked 18 hours and earned the same amount each hour.

Imena's earnings for an hour will be calculated as:-

Earning per hour = 261 / 18

Earning per hour = $14.5

Therefore, the amount paid to Imena per hour will be $14.5

To know more about an expression follow

https://brainly.com/question/24392720

#SPJ5

a 38.6 kg is a marble slab is shown above. what is the density

Answers

The question is incomplete. The dimension of the marble slab is 23 cm by 17 cm by 4 cm.

Solution :

Given

The mass of the marble slab, m = 38.6 kg

                                                    = 38600 g

Length, l = 23 cm

breadth , w = 17 cm

Thickness, h = 4 cm

Therefore, volume of the slab is V = 23 x 17 x 4

                                                         = [tex]$1564 \ cm^3$[/tex]

We know,

[tex]$\text{density}= \frac{\text{mass}}{\text{volume}}$[/tex]

          = [tex]$\frac{38600}{1564}$[/tex]

          = [tex]$24.7 \ g/cm^3$[/tex]

I have $100 and I want to buy tshirt that cost $10 and sweatshirts that cost $20 how many tshirts and sweatshirts can I buy

Answers

Answer:

10 tshirts or 5 sweatshirts

Step-by-step explanation:

One t-shirt + one sweatshirt = $30.

We know that $100 ÷ $30 = 3 times with $10 left over.

This leads to the conclusion that you can buy 4 t-shirts and 3 sweatshirts.

Look at the flag of Sweden below, then answer the question based on the appearance of the lines on the flag
help please help

Answers

Answer:

B. They are perpendicular to each other

Step-by-step explanation:

Perpendicular Lines are lines that intersect each other and make a (or multiple) right angles or 90°.

Answer:b

Step-by-step explanation:

In retailing there is a direct interaction with *
O producer
O
customer
O wholesaler
all of the above

Answers

I’m retailing there is a direct interaction with the answer is all of the above


Fred walked 20 miles in 8 days. If he continues walking at this rate, how many miles will he walk in 4 weeks? Be sure to set up a proportion to help you solve.

Answers

Answer:

70

Step-by-step explanation:

First, to find the constant rate divided 20 miles by 8 days.

20 ÷ 8 = 2.5

Then, we know that in one week there are seven days so we multiply 2.5 x 7

2.5 x 7 = 17.5

Lastly, multiply 17.5 times 4

17.5 x 4 = 70

MARK BRAINLIEST IF IM RIGHT PLEASE HAPPY TO HELP. HAPPY EARLY THANKSGIVING!!!!!

Other Questions
PLEASE HELP Ill give brainliest!!! What is the main idea in the woman in the snow? Someone pls help zoe has earned 650$ during the four weeks she worked at the rec center. the first 2 weeks she earned 220$ and 98$. the last 2 weeks she earned the same amount. how much money did zoe earn in the last 2 weeks What is the slope, m, and y-intercept for the line that is plotted on the grid? Triangles have a total of 180. Use the triangle below to determine the value of X. What are five ways companies target teens and vaping? What is the slope of the line that passes through the points (-8, 6) and (-5, -3) Find the product of 3 1/5 and 5/8. Express your answer in simplest form Which statement from The Number Devil best reveals that the author is using the number devil's character to promote a positive view of mathematics? "Most genuine mathematicians are bad at sums. Besides, they have no time to waste on them. That's what pocket plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason According to the following reaction, how many grams of sulfur are formed when 37.4 g of water are formed? 2HS(g) + SO(g) 3S(s) + 2HO(l) Explain reasons for 13 colonies 2. What are the two types of deeds that make up the hero's journey? what plan has been made for the HRD in nepal?