Read the article and use the information to answer the following questions.

Cystic Fibrosis

List four symptoms associated with cystic fibrosis.

Answers

Answer 1

Answer:

so hope it helps i think.

Explanation:

Chronic coughing.

Recurring chest colds.

Wheezing or shortness of breath.

Frequent sinus infections.

Very salty-tasting skin.

Answer 2

Answer: person above is correct

Explanation:


Related Questions

Which organism in the food web below is likely to store the most energy?
boa constrictor
beetle
coati
poison dart frog
sloth
strangler fig
fungus
fruit bat
A. Strangler fig
B. Boa constrictor
C. Beetle
D. Poison dart frog

Answers

Answer:

Beatle

Explanation:

Beetle in the food web below is likely to store the most energy. So, the correct option is (C).

What is Food Web?

A food web is defined as the natural interconnection of food chains and is a graphical representation of what-eats in an ecological community. Food web is also known as consumer-resource system.

A food web consists of many food chains while a food chain follows only one path as animals find food. For example, Falcon eats snake, which has eaten frog, which has eaten grasshopper, which has eaten grass. Thi shows the many different pathways that plants and animals are connected.

In this, the lower trophic level organisms have more energy than the upper trophic level because only 10% of the energy flows from one trophic level to the next. In the above case, beetles have the highest energy compared to other organisms.

Thus, Beetle in the food web below is likely to store the most energy. So, the correct option is (C).

Learn more about Food Web, here:

https://brainly.com/question/18816028

#SPJ2

Which of the following is a subsystem of an organism?

Answers

You didn’t post all of it


1. Osmosis and diffusion are same phenomena.​

Answers

Answer:

they are not the same thing. Osmosis is only for water molecules. i found this, hope it is useful,'Osmosis happens when molecules move from higher to lower concentrations, but diffusion happens when it is reversed'

Explanation:

Answer:

Explanation:

Not the same

what are the four primary uses or benefits of the nguni breed amongst South African communities?​

Answers

Answer:

Utility: The Nguni cattle are used for milk and meat; their socio-cultural functions are also important. The body conformation of the Nguni is more of a dairy than beef type but it is principally used for beef production and for work.

Explanation:

The similarity of the structures shown in the picture suggests that the organisms_______

1) have a common ancestor
2) all grew at different rates
3) live for a long time
4) evolved slowly

Answers

1 because they all had traits that had come form somthing

Pls help this is due today

Answers

Answer:

scientific method can help resolve problems logically

Answer:

b. scientific

Explanation:

the method most talked about in science is the scientific method. I've never really heard of any of the other methods, they don't make sense with the question anyway.

hope this helps! lemme know if you need more

In your own words, can you explain where a hot
spot can be found AND what does it looks like?

Answers

Answer:

well for one you can find a lot for examples like if the light of a blazing hot sun was reflecting on a wooden stick the spot where the sun is reflecting would have a red mark with smoke comming out the stop

I have no clue and the internet doenst help

Answers

Answer:

Soda

Explanation:

These are some weird questions...

I would say the canned soda since machines do most of that work anyway, while things like livestock need more human interaction, meaning more work needs to be done.

2. The formation of male and female sex cells is known as
A) gametogenesis
B) budding
C) sporulation
D) regeneration

Answers

Answer:

A . the formation of male and female sex cell is known as gametogenesis

the answer is a (gametogenesis)

which of the following involves mitotic cell division.
a. production of a fertilized egg
b. sexual reproduction
c. asexual reproduction
d. production of gametes

Answers

C asexual reproduction

DNA acts as a _____________ for living things
A. map

B. blueprint

Answers

Answer:

A. map

Explanation:

DNA acts as a map for living things.

¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada

Answers

Answer:

D.Grupos taxonomicos

Explanation:

Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.

Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.

El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.

How has the human population grown in the last 200 years? Why has human population growth accelerated in the last 200 years?

Answers

Answer:

1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world.  2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet.

Explanation:

Answer:

1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world.  2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet

Explanation:

5.
Name three factors that may affect the carrying capacity of the population. (3 points)

Answers

Carrying capacity, or the maximum number of individuals that an environment can sustain over time without destroying or degrading the environment, is determined by a few key factors: food availability, water, and space.

I hope this helped.


Which organism, roadrunner or the owl, competes more for its food?
Support your answer with evidence from the food web.

Answers

The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.

What do you mean by predators ?

Predators are animals that hunt, kill, and consume other animals (known as prey) for their sustenance. Predation is a common form of interaction between different species in many ecosystems. Predators come in many different forms, such as mammals, birds, fish, insects, and reptiles.

Predators are typically characterized by certain physical and behavioral adaptations that help them hunt and capture prey. For example, many predators have sharp teeth, claws, or beaks that are used to kill and consume their prey. Others may have specialized hunting techniques or strategies that make them highly effective predators.

The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.

Roadrunners are known to be opportunistic hunters and can feed on a wide range of prey items. They are ground-dwelling birds and use their speed and agility to catch their prey. Roadrunners are also known to eat eggs and young of other birds, including owls.

Owls, on the other hand, are nocturnal predators that are known for their exceptional hearing and vision, which enables them to hunt in low light conditions. They are also skilled hunters and can catch a variety of prey, including rodents, small mammals, and birds.

Therefore, both roadrunners and owls are capable of competing for food, but the level of competition depends on the availability of prey, habitat, and other factors. In general, the competition between these two species is likely to be limited, as roadrunners are diurnal (active during the day) and owls are nocturnal (active at night).

Learn more about  predators click here:

https://brainly.com/question/29779690

#SPJ1

Which of the following is NOT an example of natural selection? *
A. Plants with thorns are less likely to be eaten by herbivores than other members of the same species that lack thorns.

B. Bacterial populations in hospitals develop resistance to drugs used to combat infection by them.

C. Scientists breed cows that give greater amounts of milk than their ancestors.

D. Fruit fly larvae with an enzyme to break down alcohol are better able to feed on fermenting fruit than those that lack the enzyme.

E. Female fish that produce more eggs leave more offspring than those that produce fewer eggs.

Answers

Answer:

The Answer is C

Explanation:

When scientists breed cows to produce more milk, this has not occured naturally and thus is not natural selection.

Answer:

C. Scientists breed cows that give greater amounts of milk than their ancestors.

Explanation:

The scientists breed cows that give greater amounts of milk than their ancestors is not an example of natural selection. So, option (C) is correct.

sources of potassium for plants​

Answers

Answer:

mined rock powders and wood ash.

Explanation:

Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts ​

Answers

Answer:

Name one waste substance the coronary veins will remove.

…………………………………………………………………………………………………..……………………

what is photo synthesis?​

Answers

Answer:

The process autotrophs (plants) use to create food. they convert CO2 (Carbon Dioxide) and H2O (Water) into O2 (Oxygen) and glucose (sugar).

Answer:

photo synthesis is the green plants which making other organisms to convert engry into chemical

What is anatomy?

Simple answer please!
I'll give brainlist

Answers

Answer:

Anatomy is the study of the bodies of people and other animals

hope this helps

have a good day :)

Explanation:

Anatomy is the branch of biology concerned with the study of the structure of organisms and their parts. Anatomy is a branch of natural science which deals with the structural organization of living things. It is an old science, having its beginnings in prehistoric times.

Proteins secreted by Gram-negative cells face multiple obstacles, including _____. Multiple choice question. moving across the periplasmic space underlying the thick peptidoglycan layer of the cell wall moving across the plasma membrane moving across the plasma membrane and the thick peptidoglycan layer of the cell wall moving across both the plasma membrane and the outer membrane

Answers

Answer:

moving across both the plasma membrane and the outer membrane

Explanation:

Gram-negative bacteria are bacteria that have a plasma membrane, a thin peptidoglycan layer, and an outer membrane (the space between the plasma membrane and the outer membrane is known as periplasm). Moreover, Gram-positive bacteria exhibit neither outer membrane nor periplasmic space and are surrounded by thick layers of peptidoglycan. Gram-negative bacteria have developed different protein secretion systems (types I–VI and type VIII) in order to secrete proteins into the extracellular space. For such purpose, the XcpQ protein (which is an outer membrane protein from the secretin family) participates in different transport processes in Gram-negative bacteria.

helpp mee pleaseeee need help

Answers

Answer: it will increase the frequency of the action potential hope this helps

Explanation:

Which statement is true about gene expression? Give brainlist is answer right

Cells become specialized because different cells contain different sets of genes

Gene expression occurs primarily when DNA is replicated before the process of mitosis
The DNA of repressed genes gets destroyed because it is not being used

A cell becomes specialized by controlling the which proteins are produced from the cell's DNA

Answers

Answer:

I guess All of them

Explanation:

Gene expression has all of these statements as given above in text.

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

Tara, a server, has a sore throat. She takes her temperature and it reads 100°F. She should be _____.


excluded from work

allowed to continue her duties as long as she does not start to feel worse

reported to the health department

restricted from working with food

Answers

Excluded from work because there’s risk of getting someone else sick and I think cross contamination

When the homologous chromosomes align at the equator and then separate during meiosis I, they do so randomly. This event supports Mendel’s Law of

Answers

This supports the theory or mendal law of evolution bc the chromosomes Are aligned together

What is the main function of the central nervous system ? E2020

Answers

Answer:

The central nervous system (CNS) controls most functions of the body and mind. It consists of two parts: the brain and the spinal cord. The brain is the center of our thoughts, the interpreter of our external environment, and the origin of control over body movement.

Explanation:

Answer:

Main function-the interpreter of the environment and  control over body movement.

The central nervous system controls the body and mind. It has two parts, the brain and the spinal cord. The brain is the center of thoughts..

Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms

B. bacteria

C. aliens

D. related

Answers

Answer:

Hi, there the answer is D. related

Explanation:

Homologous structures are similar structures in related organisms.

Hope This Helps :)

Answer:

it is d i think

Explanation:

Graduate students monitoring the benthic organisms of a freshwater lake take samples at different depths throughout the lake and identify the invertebrate species present. In a deep region of the lake, they discover a crustacean that appears to be a new species. They decide to study its natural history. What is the first thing they should do in this study?

Answers

Answer:

Do a literature search to find natural history information on closely related species.

Explanation:

In the context,  few graduate students monitored the benthic organisms from the fresh lake water samples and identified the invertebrate species that are present.

They also discover a crustacean which appears to be the new species for which they decided to do a study on its natural history. The first thing that the graduate student should do is to do a literature search for finding a natural history on the information that are closely related species.

A 9.0 is how many times more powerful than a
4.0 on the Richter scale?

Answers

Answer:

It increases 31.7 times between whole number

values.

Explanation:

"That is, the wave amplitude in a level 6 earthquake is 10 times greater than in a level 5 earthquake, and the amplitude increases 100 times between a level 7 earthquake and a level 9 earthquake."

Other Questions
plz help ill make u brainliest A manufacturer ships its product in boxes with edges of 4 inches. If 12 boxes are put in a carton and completely fill the carton, what is the volume of the carton? no links, if ur right ill give u brainlist!! help pls *serious ppl only* Find the amount of interest for a 19-year investment of $4500 at a simple annual rateof 2.73% Which statement is false??? The headlines from the Tulsa Daily World newspaper on June 1, 1921, refer toa deadly race riot. The emphasis placed on different headlines most supportswhich of the following interpretations about the newspaper's editors?O A. They felt that Tulsa's government had not done enough to preventthe riot from breaking out.O B. They were biased toward African Americans suffering throughattacks in "Little Africa."O C. They considered white injuries more newsworthy than AfricanAmerican deaths.O D. They hoped to conceal facts that would reveal the true motivationsbehind the race riot. The triceps muscle in the back of the upper arm extends the forearm. This muscle in a professional boxer exerts a force of 2.00\times 10^32.0010 ^3 N with an effective perpendicular lever arm of 3.00 cm, producing an angular acceleration of the forearm of 120 rad/s^2 .What is the moment of inertia of the boxer's forearm? HELP PLEASE I need an answer ASAP What are the coordinates of the point on the directed line segment from (-6, -6)(6,6) to (9, -1)(9,1) that partitions the segment into a ratio of 2 to 3? Arianna earns a weekly salary of $325 plus a 6.5% commission on sales at a gift shop. How much would she make in a workweek if she sold $4800 worth of merchandise?\Solve with steps. First, then, next, after A house has well-insulated walls. It contains a volume of 105 m3 of air at 305 K.Consider heating it at constant pressure. Calculate the energy required to increase the temperature of this diatomic ideal gas by 0.7 Meiosis makes body cells.A. TrueB. False Gia is thinking of a number, witch she calls n .she adds 4 to the number and then doubles the sum.write an expression to represent Gia's number. Me and my guinea pigs be Vibing Lauren has a points card for a movie theater.She receives 60 rewards points just for signing up.She earns 5.5 points for each visit to the movie theater.She needs 104 points for a free movie ticket.Write and solve an equation which can be used to determine xx, the number of visits Lauren must make to earn a free movie ticket. what is value? WRONG ANSWERS ONLYY Will I get in trouble for plagiarism if I take a short story I wrote and turn it into a novel if it's the same teacher? Can yall help me on question 17?! Identify which statement is true about "Elements and Compounds" 1 A. Individual elements join together and constitute a compound B. Compounds have same type of atoms C. Chemical symbols represent Compounds D. Elements can be broken down into smaller substances how can discussion project campaign and events support victims of xenophobia