Solve for x: x+ 1/6 = 5/12

Answers

Answer 1

Answer:

x=3/12 or 1/4

Step-by-step explanation:

x + 1/6 = 5/12

x + 2/12 = 5/12

x = 3/12

converts to 1/4

Answer 2

Answer:

x= 1/4

Step-by-step explanation:

5/12- 1/6 = 1/4


Related Questions

25 pts! Dont copy someone elses work plz

Explain why the equation (x-4)^2-28=8 has two solutions. Then solve the equation to find the solutions. Show your work

Answers

Answer:

x = −2 or x = 10

Step-by-step explanation:

for the explanation see the image

7th grade math
please help, I will give brainliest
-19 = -2/3 x
find the value of x

Answers

Answer:

-19=-2/3x

3*-19=-2x

-57=-2x

-57/-2=x

57/2=x

x=28.5

Step-by-step explanation:

Answer:

x = [tex]\frac{57}{2}[/tex]

Step-by-step explanation:

Given

- 19 = - [tex]\frac{2}{3}[/tex] x ( multiply both sides by 3 to clear the fraction )

- 57 = - 2x ( divide both sides by - 2 )

[tex]\frac{-57}{-2}[/tex] = x , that is

x = [tex]\frac{57}{2}[/tex]

how do i simplify 4^(n-2)+4^(n-1)+...+4^0​

Answers

add them all up or Mutiply and Divide all together I think

In 2014, 85 percent of households in the United States had a computer. For a randomly selected sample of 200 households in 2014, let the random variable C represent the number of households in the sample that had a computer. What are the mean and standard deviation of C ?

Answers

Answer:

The mean of C is 170 households

The standard deviation of C, is approximately 5 households

Step-by-step explanation:

The given parameters are;

The percentage of households in the United States that had a computer in 2014 = 85%

The size of the randomly selected sample in 2014, n = 200

The random variable representing the number of households that had a computer = C

Therefore, we have;

The probability of a household having a computer P = 85/100 = 0.85

Let

Therefore;

The mean (expected) number in the sample, μₓ, = E(x) = n × P is given as follows;

μₓ = 200 × 0.85 = 170

The mean of C = μₓ = 170

The variance, σ² = n × P × (1 - P) = 200 × 0.85 × (1 - 0.85) = 25.5

Therefore;

The standard deviation, σ = √(σ²) = √(25.5) ≈ 5.05

The standard deviation of C, σ ≈ 5 households (we round (down) to the nearest whole number)

The mean and the standard deviation of C are 170 and 5.05 respectively

The given parameters are:

[tex]\mathbf{n = 200}[/tex] -- the sample size

[tex]\mathbf{p = 85\%}[/tex] -- the proportion of household that had a computer

(a) The mean

This is calculated as:

[tex]\mathbf{\bar x = np}[/tex]

So, we have:

[tex]\mathbf{\bar x = 200 \times 85\%}[/tex]

[tex]\mathbf{\bar x = 170}[/tex]

(b) The standard deviation

This is calculated as:

[tex]\mathbf{\sigma = \sqrt{np(1 - p)}}[/tex]

So, we have:

[tex]\mathbf{\sigma = \sqrt{170 \times (1 - 85\%)}}[/tex]

[tex]\mathbf{\sigma = \sqrt{170 \times 15\%}}[/tex]

[tex]\mathbf{\sigma = \sqrt{25.5}}[/tex]

Take square roots

[tex]\mathbf{\sigma = 5.05}[/tex]

Hence, the mean and the standard deviation of C are 170 and 5.05 respectively

Read more about mean and standard deviation at:

https://brainly.com/question/10729938

Do imaginary numbers follow the rules of algebra?

Answers

Answer:

no

Step-by-step explanation:

No they do not.

Hope this helps!

Solve - 2x - 7 > 5x + 14.
O A. x < -3
B. X > -3
C
C. x < -5
D. I > -5
please help

Answers

Answer:

hope this is not to hard to understand

Answer: Thanks for the points

Step-by-step explanation:

Help megagaagsgsh fdndjfjdd

Answers

Step-by-step explanation:

a) The graph shows how many adults and youths attended the movies on Friday, Saturday and Sunday.

b) On Friday, more adults attended the movies then youths.  On Saturday and Sunday, more youths attended the movies then Adults.

c) 1) Saturday is the most popular day to go to the movies because there was 500 adults and 650 youths for a total of 1150 people.  Friday had 950 people and Sunday had 800 people.

Which shows the equation below written in the form ax2 + bx + c = 0?
x + 9 = 4(x-1)^2
LOOK AT THE PICTURE REALLY EASY

Answers

Answer:

D

Step-by-step explanation:

We have the equation:

[tex]x+9=4(x-1)^2[/tex]

To convert this to standard form, we can simply expand.

First, expand the right-hand side:

[tex]x+9=4(x^2-2x+1)[/tex]

Distribute the right:

[tex]x+9=4x^2-8x+4[/tex]

Subtract 9 from both sides:

[tex]x=4x^2-8x-5[/tex]

Finally, subtract an x from both sides:

[tex]0=4x^2-9x-5[/tex]

Flip:

[tex]4x^2-9x-5=0[/tex]

Hence, our answer is D.

Given the following equations:
Equation 1
5x+2y=7
Equation 2
x+y=5
Find the value of 4x + y

Answers

Answer:

2

Step-by-step explanation:

Given

Equations

5x+2y=7 x+y=5 To find The value of 4x + ySolution

Subtract the second equation from the first one side-by-side:

5x + 2y - (x+ y) = 7 - 55x - x + 2y - y = 24x + y = 2

The answer is 2

A restaurant freezes a cherry and lime juice mixture to create slushes. Cherry juice costs $5 per quart, and lime juice costs $3 per quart. Each day, the restaurant spends a total of $36 on 8 quarts of juice. The restaurant manager organizes the information in the table below.

Answers

Answer:

Answer is at the bottom!

Step-by-step explanation:

Cherry juice=5+5+5+5+5+5=30

Lime juice =3+3=6

6 cherry slushes and 2 lime slushes were sold.

Hope this helps!!

Answer:

6 cherry slushes and 2 lime

Step-by-step explanation:

A store is having a 20%-off sale on all merchandise. If Mai buys one item and saves $13, what was the original price of her purchase? Explain or show your reasoning.

Answers

Answer:

The original price of her purchase was $65.

Step-by-step explanation:

From the information given, you know that $13 represents 20% of the original price and you can use a rule of three to find the value that represents 100%, which would be the original pice of her purchase:

$13 →  20%

 x   ← 100%

x=(13*100)/20

x=1300/20

x=65

According to this, the answer is that the original price of her purchase was $65.

find the explicit formula for the following sequence.
15, 29, 49, 75, 107,....

Answers

Answer:

Step-by-step explanation:

We are given the sequence

[tex]15, 29, 49, 75, 107\\15->29 = 14\\29 -> 49 = 20\\49->75 = 26\\75 -> 107 = 32\\14, 20, 26, 32\\14 -> 20= 6\\20 -> 26 = 6\\26 -> 32 = 6\\\\6, 6, 6\\6->6 = 0[/tex]

Since we had to find the differences twice, it is a second degree polynomial

[tex]y = an^2 + bn + c\\plugging \: in \: n = 1, 2, 3...\\the \: sequence \: is \\a+b+c, 4a + 2b + c, 9a + 3b + c...\\the \: diff \: under \: is \\3a + b, 5a + b, 7a + b...\\the \: diff \: under \: is \\2a, 2a, 2a...\\so, \\2a = 6\\a = 3\\3(3) + b = 14\\b = 5\\\\a +b + c = 15\\3 + 5 + c = 15\\c = 7\\[/tex]

so,

[tex]y = 3n^2 + 5n + 7[/tex]

Find f(-3) if f(x) = x^2.

- -9

- -6

- 6

- 9​

Answers

Answer:

Plz I don't understand everything

What is the binary number for 23​

Answers

Answer:

10111

Step-by-step explanation:

Answer:

♡ hi again, queen! ♡

- It's 10111.

have a great day!

✧・゚: *✧・゚:・゚✧*:・゚✧・゚: *✧・゚:・゚✧*:・゚✧

Step-by-step explanation:

A rectangular prism is 7 inches long 10 inches wide and 6 inches tall a what is the length of its longest diagonal to the nearest 10th of an inch

Answers

Answer:

c

Step-by-step explanation:

x= 7
what does the following expression equal:
3+6x-12x+14

Answers

Answer:

-25

Given:

x=7

Step-by-step explanation:

3+6x-12x+14

⇒ 3 + 6(7) - 12(7) + 14

⇒ 3 + 42 - 84 + 14

⇒ 45 - 84 + 14

⇒ -39 + 14

⇒ -25

hope you understood!

3+42-84+14=
Work from left to right
45-84+14=
-39+14=
ANSWER: -25

In a circle with radius 0.2,
an angle intercepts an arc
of length 0.1. Find the
angle in radians to the
nearest 10th

Answers

Answer: 0.5

Step-by-step explanation:

Find the slope of the line passing through each of the following pairs of points.

(5, 0), (−3, 0)

Answers

Answer:

0

Step-by-step explanation:

m= y2-y1/x2-x1

=0-0/-3-5

=0/-8

=0

Answer:

Slope = 0

Step-by-step explanation:

If the pattern continues, how many tiles would be in the 62nd stage?

A. 127
B. 129
C. 131
D. 307​

Answers

A is the answer I got hope this helps !!

Use the distributive property to write an expression that is equivalent to the sum of 9 and 54.
9(1 + 6)
9(9 + 6)
9(1 + 54)
9(1) + 9(54)

Answers

the answer is the first one 9(1+6)

Answer:

A-9(1=6)

Step-by-step explanation:

Correct on edg

In 1927, Charles Lindburgh had his first solo flight across the Antlantic Ocean. He flew 3,610 miles in 33.5 hours. If he flew about the same number of miles each hour, how many miles did he fly each hour?

Answers

Answer:

107.76

Step-by-step explanation:

We are told in the above question that:

He flew 3,610 miles in 33.5 hours. If he flew about the same number of miles each hour, how many miles did he fly each hour?

We solve the above question by:

33.5 hours = 3610 miles

1 hour = x miles

Cross Multiply

33.5 hours × x miles = 3610 miles × 1 hour

x miles = 3610 miles × 1 hour/33.5 hours

x miles = 107.76119403 miles

Approximately = 107.76 miles per hour

Therefore, he flew 107.76 miles each hour

find the mausure of 1​

Answers

Answer:

88

Step-by-step explanation:

Every triangle has a measure of 180, so if we know two of the angles we can find the last one easily. To find angle 1, we first must find angle 2. 2 must be equal to 42 because it is vertical to the other angle that is equal to 42 degrees. Then to find angle 1 do the operation 180-(50+42). This equals 88, which is the measure of angle 1.

what is 15/8 simplyfied ?

Answers

Answer:

mixed number 1 7/8 or decimal form 1.875

Answer:

it cant be simplified but it can be converted into a mixed number. which is

1 7/8. hope this helps <3

Step-by-step explanation:

The property taxes on a house were $2610. What was the tax rate if the house was valued at $290,000? Follow the problem-solving process and round your answer to the nearest hundredth of a percent, if necessary.

Answers

Hi

2 610  /  290  000  *100 = 0.9 %

Less than 1%

The tax rate if the house was valued at $290,000 was Less than 1%.

What is the fundamental principle of multiplication?

Multiplication is the mathematical operation that is used to determine the product of two or more numbers. If an event can occur in m different ways and if following it, a second event can occur in n different ways, then the two events in succession can occur in m × n different ways.

We are given that property taxes on a house were $2610.

We need to find the tax rate if the house was valued at $290,000.

Therefore,

2610  /  290 000  x 100 = 0.9 %

Hence, the tax rate if the house was valued at $290,000 was Less than 1%.

Learn more about multiplications;

https://brainly.com/question/14059007

#SPJ5

What is the x intercept of 4y+9x=18

Answers

Answer:

Step-by-step explanation:

step 1. 4y+9x=18

step 2. 4y=-9x+18

step 3. idk

Answer:

(2,0)

plug 0 for y and solve

hey will give brainiest if correct

Answers

3 inches i agree too 2020

jamie and rhyns share some money in the ratio of 2:3.jamie gets 40 pounds. how much does rhys get.

Answers

Answer:

60 pounds

Step-by-step explanation:

The ratio of Jamie to Rhys is 2 to 3.

Jamie gets 40 pounds.

40 pounds is 20 times 2, so Rhys also has to get 20 times the amount in the ratio.

20 * 3 = 60

Answer: 60 pounds

please answer quick and no the answer isn’t 15

Answers

since the angle is a 180 degree angle

180-73= 107

the angle is 107 degrees

Answer:

107

Step-by-step explanation:

The two angles would make a linear pair, which means they're supplementary to each other. Supplementary angles add up to 180.

This allows us to do 180 - 73 = 107

x would be 107.

A Game Center has a $5 admission fee and charges $0.50 for each game played. Write an equation that represents the cost, C, in dollars, of playing n games at this Game Center. Explain your reasoning.

Answers

Answer: $0.50c+$5=n Jensen

Aaron is bicycling on a bike trail at an average of 10 miles per hour. Jada starts cycling on the same trail 30 minutes later. If Jada averages 16 miles per hour, how long would it take her to pass Aaron?

Answers

Answer:

36 miles per hour

Step-by-step explanation:

36 miles per hour

Other Questions
(6th grade math) yasiara has 3/4 of cake. she wants to divide it up into 1/12 size pieces. how many pieces will she have? ( can you show work please) Me gusta tocar ___________. can someone help meWhat is the missing numerator?blank over seven plus thirteen over fourteen equals one and three fourteenths (20 points) a11 b8 c5 d2 PLEASE HELP Ill give brainliest!!! What is the main idea in the woman in the snow? Someone pls help zoe has earned 650$ during the four weeks she worked at the rec center. the first 2 weeks she earned 220$ and 98$. the last 2 weeks she earned the same amount. how much money did zoe earn in the last 2 weeks What is the slope, m, and y-intercept for the line that is plotted on the grid? Triangles have a total of 180. Use the triangle below to determine the value of X. What are five ways companies target teens and vaping? What is the slope of the line that passes through the points (-8, 6) and (-5, -3) Find the product of 3 1/5 and 5/8. Express your answer in simplest form Which statement from The Number Devil best reveals that the author is using the number devil's character to promote a positive view of mathematics? "Most genuine mathematicians are bad at sums. Besides, they have no time to waste on them. That's what pocket plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason According to the following reaction, how many grams of sulfur are formed when 37.4 g of water are formed? 2HS(g) + SO(g) 3S(s) + 2HO(l)