Someone help me pls :/ asap :(

Someone Help Me Pls :/ Asap :(

Answers

Answer 1

Answer: 6, -1

Step-by-step explanation:

1. Look at both of the lines. (Blue and purple)

2. Which dot connects to both lines? (The dot which is green)

3. Since they’re together, that’s the answer.

4. Find the coordinates.

5. Go to “0” and go left until you hit the green dot area. (6 as X axis)

6. Go down to the green dot to find the Y coordinate. (-1 as Y axis)

7. You got the answer (6, -1) !


Related Questions

Christopher has 100 flavored donuts to sell. Each flavored donut is covered with one topping. How many flavored donuts are covered with sprinkles?

Answers

25 doughnuts because

pls help I will mark brainliest I dont have alot of points tho

Answers

9/8 feet per hour fast is Kelly's knitting speed
Step-by-step explanation:
Unit rate defined as the rates are expressed as a quantity 1 such as 4 meter per seconds or 4 miles per hour.
As per the statement:
Kelly is knitting a scarf for her brother. it took her 1/3 hour to knit 3/8 foot of the scarf.
She took /3 hour to knit 3/8 foot of the scarf.

So the answer is 9/8 feet per hour

Yo can I get some help with this question

Answers

Answer:

Step-by-step explanation:

D is congruent to b so the answer is equal to 45 + 3x -10 + 2x + 10 = 180 . this can be to 45 + 5x = 180, and further to 5x + 135 to x=27

One degree of longitude at the equator is approximately 111 km. As we move north or south the size of a degree changes. How many kilometers would 1° of longitude measure in kilometers at 45° latitude north? A. 55.5 kilometers B.222 kilometers C. 444 kilometers D. 0 kilometers

Answers

Answer:

B.

Step-by-step explanation:

55.5 kilometers would be 1° of the longitude measure in kilometers at 45° latitude north.

What are longitude and latitude?

Latitudes are horizontal lines that indicate how far away from the equator a location is. Longitudes are vertical lines that represent the east and west directions relative to Greenwich, England's meridian. Cartographers, geographers, and others can pinpoint points or locations on the globe by combining latitude and longitude.

Given, At the equator, one degree of longitude is around 111 kilometers. The size of a degree fluctuates as we go north or south. since the equator is perpendicular to the pole. which is 90 degrees hence it's asking distance of 45 therefore from the proportionality concept in a right angle triangle. the distance at 1 is at 45 latitudes is 111/2 or 55.5.

Therefore, At 45° latitude north, 55.5 kilometers would represent 1° of the longitude measurement in kilometers.

Learn more about longitude and latitude here:

https://brainly.com/question/13492273

#SPJ2

Veronica bought 20 bags of candy for a school dance. The first 5 bags cost $1.79 each. The rest of the bags cost $1.19 each.

How much did Veronica spend on candy?
A. 8.95
B. 17.90
C. 26.80
D. 35.80

Answers

Answer:

Your answer is C. 26.8

Step-by-step explanation:

5 × 1.79 = 8.95

15 × 1.19 = 17.85

8.95 + 17.85 = 26.8

Answer:  C ($26.80)

Step-by-step explanation:

This is a multiplication problem.

The first 5 bags of candy cost $1.79 each, so we multiply the cost by the amount of bags that we bought for that price:

5 * 1.79 = $8.95

The rest of the bags cost $1.19 each, so we need to multiply this number by some value. To find this value, we need to know how many bags we have left. We already bought 5, and we bought a total of 20, so we need to buy:

20 - 5 = 15 bags

Multiplying the cost for the rest of the bags (1.19) by the amount of bags we need to buy still (15), we get:

15 * 1.19 = $17.85

Now we know what the cost of the first 5 bags (8.95), and we know the cost of the 15 other bags (17.85). To find the total amount of money Veronica spent, we can just add these two values together.

8.95 + 17.85 = $26.80

This total cost is shown in answer C, so that is the answer.


Help pls help me!!!!!

Answers

Answer:

C

Step-by-step explanation:

This is your answer because when you do the math you get c as your answer.

Hope this help:)

pls mark brainly

Answer:

The answer is C

Step-by-step explanation:

You had $72.31 at the beginning of the month but you deposited $11.27 and $14.76 so if you add all of those you get $19.84

Have a great day!

Please consider marking brainliest

^-^

Help ASAP I honestly really suck lol

Answers

do you remember how to find x ?
Answer: 8.3

Explanation: You’ll need to use tangent for this.

The equation would be tan(50)=x/7. Multiply 7 on both sides to isolate the x.

x=tan(50) • 7

You’ll get x=8.342275148. Rounded to the tenth is 8.3.

Calculate the measure of ABC to the nearest tenth of a degree.

Answers

Answer:

I had done rough method on the page

Step-by-step explanation:

I think first once is correct ...

TRANSPORTATION The cost of riding in a cab is $3.00 plus $0.75 per mile. The equation that represents this relation is y=0.75x+3, where x is the number of miles traveled and y is the cost of the trip. Find and interpret f(17).

Answers

Answer:

f(17) = $15.75

The amount it takes for a trip of 17 miles is $15.75

Step-by-step explanation:

Here, we want to calculate f(17)

The equation is given as;

y = 0.75x + 3

For f(17), substitute x for 17

y = 0.75(17) + 3

y = 12.75 + 3

y = $15.75

What f(17) means is that the ride was for 17 miles

$15.75 is for a trip of 17 miles

Which of the following is true about the equation y = -5x + 10?

A. The equation is proportional.

B. The equation has a positive slope.

C. The equation has a positive y-intercept.

D. The equation has a negative y-intercept.
TG

Answers

Answer:

C and most likely A

Step-by-step explanation:

A) The equation is proportional.

If the equation forms a straight line on a graph, having a slope that is neither zero or infinity, it is proportional.

B) The equation has a positive y-intercept.

The y intercept in the equation is variable b. Since the equation has +10, it is positive.

Hope this is correct and that it helps✨❤️

Solve for X : 8x + 3 = 2x

Answers

Answer:

x = -1/2

Step-by-step explanation:

12 people in line at an ice-cream shop 8 ordered cones with 2 scoops of ice cream the rest ordered cones with 1 scoop what is the ratio

Answers

Answer:

2:1

Step-by-step explanation:

Is "The weight of a stack of standard 8.5x11 copier paper vs. number of sheets of paper." a proportional relationship?

Answers

Answer:Yes it is proportional because w=kp k=paper weight which is constant. The relationship between the weight of a stack of standard 8.5x11 copier paper vs number of sheets of paper is proportional.

Step-by-step explanation:

Answer: Yes it is a direct proportional relationship

================================================

Explanation:

The equation is in the form y = kx, where

x = number of sheets of paper

k = weight of 1 sheet of paper

y = weight of all the x sheets of paper

x is some nonnegative whole number. The values of y and k are some nonnegative real numbers (aka any decimal values).

Note how if we had x = 0 pieces of paper, then y = 0 is the weight. So no paper leads to no weight. This visually is shown by the line y = kx going through the origin. All direct proportion equations go through the origin.

Each time we add a sheet of paper, we add on k ounces or k grams, or whatever units you're working with. The amount is constant assuming you are dealing with the same type of paper. Comparing y = kx with y = mx+b, we see that k plays the role of the slope or rate of change.

Factor the expression completely
6x²-4x²-16x

Answers

Answer: 2x(x - 8)

6x² - 4x² - 16x

= 2x² - 16x

= 2x(x - 8)

Step-by-step explanation:

Answer:

2x(x-8)

Step-by-step explanation:

Evaluate.

6x²-4x²-16x = 2x²-16x

Factorise 2x.

2x²-16x = 2x(x-8)

Plz help I’m getting timed

Answers

Answer:

16

Step-by-step explanation:

Answer: Your answer is 16.

Step-by-step explanation:

Select the equation that shows a proportional relationship between x and y. Oy - 2x + 4 oys 5x O y = 3x - 5 OY-5.8​

Answers

Given:

There exist a proportional relationship between x and y.

To find:

The equation which represents a proportional relationship between x and y.

Solution:

If there exist a proportional relationship between x and y, then

where, k is constant of proportionality.

We know that, proportional relationship passes through the origin because (0,0) satisfy .

For x=0, check which equation has y=0.

In option A, .

In option B, .

In option C, .

In option D,  

Only in option C, we have a equation of the form  with 4 as constant of proportionality and it passes through (0,0).

Therefore, the correct option is C.

Answer:

You can give China brainiest.

Step-by-step explanation:

Meg has 5 milligrams of zinc and 0.93 milligram of silver.
How much more zinc does she have than silver?
Pls help answer only if ya know

Answers

4.07 milligrams more of zinc

Write an equation for the line in​ slope-intercept form, where x is the number of tickets and y is the total cost.

Write an equation for the line in​ slope-intercept form, where x is the number of tickets and y is the total cost.

The equation for the line in​ slope-intercept form is ?

Answers

Answer:

Y= 21x+10.25

Step-by-step explanation:

(1,31.25) (0,10.25)

Slope= 21

21X-0=y-10.25

Y= 21x+10.25

Write an equation in slope-intercept form with the given slope and y-intercept.

Answers

Answer: slope: 3/2

y-intercept: 0,4

Step-by-step explanation:

Answer: y= 3x/2 -4

Step-by-step explanation:

It is already in slope-intercept form: y = mx + b

At the craft store, Mateo bought a bag of green and orange marbles. He received 27 green marbles and 63 orange marbles. What percentage of the marbles were green?

Answers

Answer:

30%

Step-by-step explanation:

The sum of two numbers is 60. One number is 4 times as large as the other. What are the numbers? Larger number: Smaller number:

Answers

Answer:larger=48, smaller=12

Source:trust me bro

3(2y + 4) = 7y + 4 - y y =

I cant get an accurate answer for this problem Help!​

Answers

Answer:

No solutions

Step-by-step explanation:

3(2y + 4) = 7y + 4 - y

~Simplify both sides

6y + 12 = 6y + 4

~Subtract 12 to both sides

6y = 6y - 8

~Subtract 6y to both sides

0 = 8

Best of Luck!

43+9=10+42 and 10+42=52, then 43+9

Answers

52=52 and 52=52 and 52=52

 Please create a graph to reflect the following situation:

Max is going to school. For the first 20 minutes he walks at a constant speed of 10 miles per hour. Then he gets to the bus stop and waits for the bus for another 5 minutes. Then he rides the bus for 10 minutes. The speed of the bus is 40 miles per hour.
Show graphically the distance Max has traveled to school over time since he has left his house.

Make sure you include the name of the graph, the labels and the scale on x- and y-axes; Please use graphing paper, pencil and a ruler. Please help me it’s due today I would love the help.

Answers

You show the time on the x-axes (from 0 to 35) and the distance on the y-axes (from 0 to 10).

You start at origin of coordinates. Then the graph rises linear until it reaches the point (20|3.3333...), then it is parallel to the x-axes (as he does not move) until it reaches (25|3.3333...). Then it increases again until it reaches (35|10).

Basically, it's linear all the time, while the slope of the graph varies in three different intervals. (Actually it wouldn't be linear as he doesn't move with the same speed all the time but we can't go more into detail based on the information we have, so we use average values.)

You can use the rule of three to find out how far he moves.

mark brainliset pls answer

Answers

Answer:

I'm pretty sure it's 18 square units

Step-by-step explanation:

Hope this helps!

Answer:

18 square units or option B

Step-by-step explanation:

Find area of whole rectangle: 6x4 or 24 sq inches.

3 by 2 triangles = 6. 24-6 is 18.

Hope this helps plz hit the crown :D

Help please...............

Answers

Answer is D

Because 0.36-0.26 is 0.1 and so is 0.26-0.16 and so on.

Plzzzz helpppp!!!!what are the coordinates of the point on the directed line segments from (-6,-4) to (4,6) that partitions the segment into a ratio of 2 to 3?

Answers

Answer:

(2/3, 8/3)

Step-by-step explanation:

Using the line segment equation we get: (x,y)=(-6+2/3(4-(-6)), -4+2/3(6-(-4))=(2/3,8/3)

Answer:

Full Answer

Step-by-step explanation:

(-2,0)

78/329 times 890/2800 (900/322 x 780/900)

Answers

32713/3218120





...........

HELP ME PLS IM DUMB!!!

Answers

Answer:

ur not dumb dw

Step-by-step explanation:

a) 5/6x+8

b)-3/4x-2

write Luke earned commission on each pair of jeans he sold. Luke sold $342 worth of jeans and made $112. Approximately what is Luke's commission rate?

whoever answers this first gets 15 points and a brainliest!

Answers

230 is his commission rate
Other Questions
|-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble. . Why is spell check not completely reliable as an editor? is francium found in nature or lab? what is a film interpretation The students are trying to raise 3.000 but they only have 1200 how much would they need to get to 3000 According to the graph below, at which point is the plant preforming the most photosynthesis? A. Point D. B. Point B. C. Point C. D. Point A. How did African American life compare to the typical white person's life in the 1950's?