Superman needs to save Lois from the clutches of Lex Luthor. After flying for 14 seconds, he is 1372 meters from her. Then at 18 seconds he is 1164 meters from her.
A. What is Superman's average rate? _____ meters per second
B. How far does Superman fly every 15 seconds? _________meters
C. How close to Lois is Superman after 33 seconds? ________meters

Answers

Answer 1

The average rate of Superman can be calculated by dividing the change in distance by the change in time.

Average rate = (final distance - initial distance) / (final time - initial time)

Average rate = (1164 - 1372) / (18 - 14)

Average rate = -208 / 4

Average rate = -52 meters per second

To find how far Superman flies every 15 seconds, we can use the concept of proportionality. Since we know the rate at which Superman is flying, we can set up a proportion to find the distance.

Rate = Distance / Time

-52 meters per second = Distance / 4 seconds

Distance = -52 * 15

Distance = -780 meters (Note: Distance cannot be negative, so we consider the magnitude)

C. To determine how close Superman is to Lois after 33 seconds, we can use the average rate to calculate the distance traveled.

Distance = Average rate * Time

Distance = -52 * 33

Distance = -1716 meters (Note: Distance cannot be negative, so we consider the magnitude)

To learn more about average rate

brainly.com/question/28739131

#SPJ11


Related Questions

Use the Central Limit Theorem to find the mean and standard error of the mean of the indicated sampling distribution. The monthly rents for studio apartments in a certain city have a mean of $900 and a standard deviation of $180. If random samples of size 30 are drawn from the population, identify the mean, wx, and standard deviation, 7, of the sampling distribution of sample means with sample size n

Answers

Mean of the sampling distribution (wx): $900

Standard error of the mean (σx): Approximately $32.92

To find the mean and standard error of the mean of the sampling distribution, we can use the Central Limit Theorem.

The Central Limit Theorem states that for a large enough sample size, the sampling distribution of the sample means will be approximately normally distributed, regardless of the shape of the population distribution.

In this case, the population mean is μ = $900 and the population standard deviation is σ = $180. We are drawing random samples of size n = 30 from this population.

The mean of the sampling distribution (wx) will be equal to the population mean (μ), which is $900.

The standard deviation of the sampling distribution (σx), also known as the standard error of the mean, can be calculated using the formula:

σx = σ / √n

where σ is the population standard deviation and n is the sample size.

Substituting the given values, we have:

σx = $180 / √30

Calculating this value, we find:

σx ≈ $32.92

Therefore, the mean of the sampling distribution (wx) is $900, and the standard error of the mean (σx) is approximately $32.92.

Please note that the Central Limit Theorem assumes a sufficiently large sample size (typically n ≥ 30) for the approximation to hold.

To know more about sampling distribution:

brainly.com/question/13501743

#SPJ4

Suppose a brewery has a filling machine that fills 12 ounce bottles of beer. It is known that the amount of beer poured by this filling machine follows a normal distribution with a mean of 12.29 ounces and a standard deviation of 0.04 ounce. Find the probability that the bottle contains between 12. 19 and 12.25 ounces.

Answers

The probability that the bottle contains between 12.19 and 12.25 ounces is 0.1525.

Given, mean (μ) = 12.29 ounces and standard deviation (σ) = 0.04 ounce.

We need to find the probability that the bottle contains between 12. 19 and 12.25 ounces.

So, let X be the amount of beer filled by the machine. Then, X ~ N(12.29, 0.04²)

Let Z be the standard normal random variable.

Then, Z = `(X - μ)/σ`

Substituting the values, we get,Z = `(X - 12.29)/0.04`

For X = 12.19, `Z = (12.19 - 12.29)/0.04 = -2.5`

For X = 12.25, `Z = (12.25 - 12.29)/0.04 = -1

`Now we need to find the probability of Z being between -2.5 and -1.P(Z lies between -2.5 and -1) = P(-2.5 < Z < -1)

We know that P(Z < -1) = 0.1587 and P(Z < -2.5) = 0.0062

From standard normal distribution table, we get

P(-2.5 < Z < -1)

= P(Z < -1) - P(Z < -2.5)P(-2.5 < Z < -1)

= 0.1587 - 0.0062 = 0.1525

Therefore, the probability that the bottle contains between 12.19 and 12.25 ounces is 0.1525.

#SPJ11

Let us know more about probability: https://brainly.com/question/32117953.

sketch the graph of a function that has a local maximum at 6 and is differentiable at 6.

Answers

To sketch the graph of a function that has a local maximum at 6 and is differentiable at 6, we can consider a function that approaches a maximum value at 6 and has a smooth, continuous curve around that point.

In the graph, we can depict a curve that gradually increases as we move towards x = 6 from the left side. At x = 6, the graph reaches a peak, representing the local maximum. From there, the curve starts to decrease as we move towards larger x-values.

The important aspect to note is that the function should be differentiable at x = 6, meaning the slope of the curve should exist at that point. This implies that there should be no sharp corners or vertical tangents at x = 6, indicating a smooth and continuous transition in the graph.

By incorporating these characteristics into the graph, we can represent a function with a local maximum at 6 and differentiability at that point.

To learn more about differentiable click here:

brainly.com/question/24898810

#SPJ11








4. Solve the Cauchy-Euler equation: x"y" - 2x*y" - 2xy +8y = 0 (12pts)

Answers

the general solution to the Cauchy-Euler equation x³y'" - 2x²y" - 2xy' + 8y = 0 is given by y(x) = c₁x² + c₂x⁻¹ + c₃x⁻¹ln(x) where c₁, c₂, and c₃ are constants.

To solve the Cauchy-Euler equation x³y'" - 2x²y" - 2xy' + 8y = 0, we'll make the substitution y = [tex]x^r[/tex], where r is a constant.

Let's differentiate y with respect to x:

y' = [tex]rx^{r-1}[/tex]

y" = [tex]r(r-1)x^{r-2}[/tex]

y'" = [tex]r(r-1)(r-2)x^{r-3}[/tex]

Now, substitute these derivatives into the original equation:

[tex]x^3(r(r-1)(r-2)x^{r-3} - 2x^2(r(r-1)x^{r-2}) - 2x(rx^{r-1}) + 8x^r = 0[/tex]

Simplifying, we get:

[tex]r(r-1)(r-2)x^r - 2r(r-1)x^r - 2rx^r + 8x^r = 0[/tex]

Combining like terms, we have:

r(r-1)(r-2) - 2r(r-1) - 2r + 8 = 0

Simplifying further, we get:

r³ - 3r² + 2r - 2r² + 2r + 8 - 2r + 8 = 0

r³ - 3r² + 8 = 0

To solve this cubic equation, we can try to find a rational root using the Rational Root Theorem or use numerical methods to approximate the roots.

By inspection, we find that r = 2 is a root of the equation. This means (r - 2) is a factor of the equation.

Using long division or synthetic division, we can divide r^3 - 3r^2 + 8 by (r - 2):

  2  |   1    -3    0    8

      |       2   -2   -4

_______________________

       1    -1   -2    4

The quotient is r² - r - 2.

Factoring r² - r - 2, we get:

r² - r - 2 = (r - 2)(r + 1)

So the roots of the equation r³ - 3r² + 8 = 0 are: r = 2, r = -1 (repeated root).

Therefore, the general solution to the Cauchy-Euler equation x³y'" - 2x²y" - 2xy' + 8y = 0 is given by:

y(x) = c₁x² + c₂x⁻¹ + c₃x⁻¹ln(x)

where c₁, c₂, and c₃ are constants.

Learn more about Cauchy-Euler equation here

https://brainly.com/question/31419735

#SPJ4

Given question is incomplete, the complete question is below

Solve the Cauchy-Euler equation:

x³y'" - 2x²y" - 2xy' + 8y = 0

To find the x-intercept, we let y = 0 and solve for x and to find y-intercept, we let x=0 and solve for y. Figure out the x-intercept and y-intercept in given equation of the line.
6x + 2y = 12

Answers

Answer:

x-intercept = 2

y-intercept = 6

Step-by-step explanation:

x-intercept:  6x = 12;  x = 2

y-intercept:  2y = 12;  y = 6

Find the surface area of a square pyramid with side length 6 mi and slant height 7 mi.

Answers

Answer:

total surface area (TSA) = [tex]2bs[/tex] + [tex]b^{2}[/tex]

                      length      = 6 mi

                    slant height = 7 mi

           ∴ TSA                   = 2 × 6 × 7 + [tex]6^{2}[/tex]

                                       = 84 + 36

                                      = 120

The surface area of the square pyramid is 120 sq. mi.

Given:

side length (s) = 6 mi

slant height (l) = 7 mi

*image of a typical square pyramid is shown in the attachment below.

Recall:

Formula for surface area of square pyramid (SA) = [tex]A + \frac{1}{2} Pl[/tex]

Where,

[tex]A =[/tex] area of the base = [tex]s^2 = 6^2 = 36[/tex] sq mi

[tex]P =[/tex] perimeter of the base = [tex]4(s) = 4\times 6 = 24[/tex] mi

[tex]l =[/tex] slant height = 7 mi

Plug in the values

[tex]SA = 36 + \frac{1}{2}\times 24\times 7\\SA = 36 +84\\SA = 120[/tex]

The surface area(SA) of the square pyramid is 120 sq. mi

Learn more about surface area of a square pyramid here:

https://brainly.com/question/8830629

Let 1 f(z) = z²+1 Determine whether f has an antiderivative on the given domain G. You must prove your claims. (a) G=C\ {i,-i}. (b) G= {z C| Rez >0}.

Answers

f(z) = z^2 + 1 has an antiderivative on the domain G = C \ {i, -i}.

(b) Hence, we cannot determine whether f(z) = z^2 + 1 has an antiderivative on the domain G = {z in C | Re(z) > 0} based on the Cauchy-Goursat theorem alone.

(a) To determine whether f(z) = z^2 + 1 has an antiderivative on the domain G = C \ {i, -i}, we can check if f(z) satisfies the Cauchy-Riemann equations on G.

The Cauchy-Riemann equations state that for a function f(z) = u(x, y) + iv(x, y) to have a derivative at a point, its real and imaginary parts must satisfy the partial derivative conditions:

∂u/∂x = ∂v/∂y and ∂u/∂y = -∂v/∂x.

For f(z) = z^2 + 1, we have u(x, y) = x^2 - y^2 + 1 and v(x, y) = 2xy.

Calculating the partial derivatives, we find:

∂u/∂x = 2x, ∂v/∂y = 2x,

∂u/∂y = -2y, ∂v/∂x = 2y.

Since ∂u/∂x = ∂v/∂y and ∂u/∂y = -∂v/∂x hold for all (x, y) in the domain G, f(z) satisfies the Cauchy-Riemann equations on G. Hence, f(z) has an antiderivative on G = C \ {i, -i}.

(b) Now, let's consider the domain G = {z in C | Re(z) > 0}. To determine if f(z) = z^2 + 1 has an antiderivative on G, we can utilize the Cauchy-Goursat theorem, which states that a function has an antiderivative on a simply connected domain if and only if its line integral around every closed curve in the domain is zero.

For f(z) = z^2 + 1, we can calculate its line integral over a closed curve C in G. However, since G is not simply connected (it has a "hole" at Re(z) = 0), the Cauchy-Goursat theorem does not apply, and we cannot conclude whether f(z) has an antiderivative on G based on this theorem.

To provide a definitive answer, further analysis or techniques such as the residue theorem may be required.

Know more about Analysis here:

https://brainly.com/question/32375844

#SPJ11

If angle A is 76ᴼ what is its supplementary angle? What is its complementary angle?

Answers

Answer:

the complementary angle is 14°

the supplementary angle is 104°

Step-by-step explanation:

76+14=90

76+104=180

Maya's fish tank has 17 liter of water in it. She plans to add 4 liters per minute until the tank has at least 53 liters. What are possible numbers of minutes Maya could add water? Use t for the number of minutes. Write your answer as an inequality solved for t.

Answers

Answer: you know it’s 9mins but Im not sure how I should make the equation probably I think (53= 9T + 4)

Step-by-step explanation:

Can someone help me with this problem

Answers

Answer:

33

Step-by-step explanation:

well we know you have a right angle and a right angle is equivalent to 90 degrees and you also have angle 57 now we know a triangle is equal to 180 so take 90+57=180 add the 90 and 57 then subtract the anwser from 180

Please help me it’s due soon-

Answers

Answer:

B-16

Step-by-step explanation:

jsjjsjdjsjsjxjsjsijsjdjdjjsjzjzijzjsndjidjsjsid

Line with a slope of -3 and passes through
point (-1,7)

Answers

Answer:

y=-3x+5.5

Step-by-step explanation:

The answer is Y=-3x+5.5 because we already know the slope which is -3. Now all you have to do is change the Y-Intercept. As you can tell the Y-Intercept is not a whole number. So you have to change it to a decimal to get the point that you want. You can put the last part of the equation as 5.5 or 5.55. It doesn't matter but 5.5 is more official. If you find any fault in my answer let me know. Thanks. Have a good day!

Let X and Y be two independent N(0,2) random variable and Z= 7+X+Y, W= 1+ Y. Find cov(Z, W) and p(Z,W).

Answers

The correlation coefficient (p(Z, W)) between Z and W is sqrt(2) / 2.

To find the covariance of Z and W and the correlation coefficient (p(Z, W)), we can use the properties of covariance and correlation for independent random variables.

Given that X and Y are independent N(0, 2) random variables, we know that their means are zero and variances are 2 each.

Covariance:

Cov(Z, W) = Cov(7 + X + Y, 1 + Y)

Since X and Y are independent, the covariance between them is zero:

Cov(X, Y) = 0

Using the properties of covariance, we have:

Cov(Z, W) = Cov(7 + X + Y, 1 + Y)

= Cov(X, Y) + Cov(Y, Y)

= Cov(X, Y) + Var(Y)

Since Cov(X, Y) = 0 and Var(Y) = 2, we can substitute these values:

Cov(Z, W) = 0 + 2

= 2

Therefore, the covariance of Z and W is 2.

Correlation Coefficient:

p(Z, W) = Cov(Z, W) / (sqrt(Var(Z)) * sqrt(Var(W)))

To calculate p(Z, W), we need to find Var(Z) and Var(W):

Var(Z) = Var(7 + X + Y)

= Var(X) + Var(Y) (since X and Y are independent)

= 2 + 2 (since Var(X) = Var(Y) = 2)

= 4

Var(W) = Var(1 + Y)

= Var(Y) (since 1 is a constant and does not affect variance)

= 2

Now we can calculate p(Z, W):

p(Z, W) = Cov(Z, W) / (sqrt(Var(Z)) * sqrt(Var(W)))

= 2 / (sqrt(4) * sqrt(2))

= 2 / (2 * sqrt(2))

= 1 / sqrt(2)

= sqrt(2) / 2

Therefore, the correlation coefficient (p(Z, W)) between Z and W is sqrt(2) / 2.

Know more about the correlation coefficient click here:

https://brainly.com/question/29704223

#SPJ11

What is the solution set for -4m ≥ 96?

Answers

Answer:

m [tex]\leq[/tex] 24

Step-by-step explanation:

-4m ≥ 96

(divide both sides by -4)

m [tex]\leq[/tex] 24

(sign flips because dividing by a negative)

Plz help. i need asap.
A bag contains blue, red, and green marbles. Paola draws a marble from the bag, records its color, and puts the marble back into the bag. Then she repeats the process. The table shows the results of her experiment. Based on the results, which is the best prediction of how many times Paola will draw a red marble in 200 trials?

A. about 300 times
B. about 140 times
C. about 120 times
D. about 360 times

Answers

Don’t click on link given in other answer, it’s a SCAM bot

△abc∼△efg given m∠a=39° and m∠f=56°, what is m∠c? enter your answer in the box. °

Answers

The value of m∠C is 85°.

Given that, △ABC ∼ △EFG. Also, m∠A = 39° and m∠F = 56°. We need to find m∠C.

Let us first write down the formula for the similarity of triangles.  The two triangles are similar if their corresponding angles are congruent.

In other words, we can write: `∠A ≅ ∠E`, `∠B ≅ ∠F`, and `∠C ≅ ∠G`.

Now, in △ABC, we have: ∠A + ∠B + ∠C = 180° (Interior angle property of a triangle)

Also, in △EFG, we have: ∠E + ∠F + ∠G = 180°(Interior angle property of a triangle)

We know that ∠A ≅ ∠E and ∠B ≅ ∠F.

Substituting these values, we get:

39° + ∠B + ∠C = 180° (From △ABC)56° + ∠B + ∠G = 180° (From △EFG)

Simplifying, we get ∠B + ∠C = 141°...(Eq 1)

∠B + ∠G = 124°....  (Eq 2)

Now, let's subtract Eq 2 from Eq 1.

We get∠C − ∠G = 17°               

Substituting values from Eq 2:

∠C − 68° = 17° ∠C = 85°

Therefore, m∠C is 85°.

T o know more about congurent angle,

https://brainly.com/question/11949261

#SPJ11

a right triangle, with a height of 4m and a width of 1m. he wants to build a rectangular enclosure to protect himself. what is the largest the area of gottfried’s enclosure can be?

Answers

Given that, height of the right-angled triangle = 4m. Width of the right-angled triangle = 1m. Let's assume that the rectangular enclosure will be built at the base of the right-angled triangle. The area of the rectangular enclosure can be obtained using the formula, Area of rectangle = length × breadth. Length of the rectangle = height of the right-angled triangle = 4mLet the breadth of the rectangle be x, then the length is the width of the right-angled triangle + x = 1 + x Hence, the area of the rectangular enclosure is given by: Area = Length × Breadth= (1+x)×4= 4x + 4m²Now, the maximum area can be obtained by differentiating the above expression with respect to x and equating it to zero: dA/dx = 4 = 0x = -1. This is not a valid solution since we cannot have a negative breadth, hence we conclude that the area is maximum when the breadth of the rectangular enclosure is equal to the width of the right-angled triangle, i.e., when x = 1m. Thus, Area of the rectangular enclosure = Length × Breadth= (1+1)×4= 8 m². Hence, the largest the area of Gottfried’s enclosure can be is 8 m².

To know more about Gottfried’s enclosure, click here:

https://brainly.com/question/29293732

#SPJ11

fill in the blank to make the statement true.

1.( )+4 506-21 000=1 001


2.698-( )+711=1 388


3.109 006-( )-66 666=23 124


some questions I have already answered only that question make me confused​

Answers

Here it is!
U just need to exchange the white (blank) for x and solve.

Jennifer ran 2 miles at the track on Tuesday. If one lap around the track is 1/4 of a mile, how many laps did she run?

Answers

Answer:

She would have ran 8 laps.

Step-by-step explanation:

4/4 = 1 mile so therefore she would need 8/8 for it to be 2 miles

Help me quick!!!!!

Donny came by and pimped 4 girls on Tuesday, he then came by again on Saturday and Sunday with 17 more! How many girls did that playa get?

Answers

Answer:

I don't know thank answer sorry I just really need points you can report me if you want but I REALLY need some

El resultado de la operación combinada 70-25+9-2x10÷2 corresponde a:
A) 9 B)44 C)80

Answers

Answer:

B) 44

Step-by-step explanation:

70 - 25 + 9 - 2 × 10 ÷ 2

70 - 25 + 9 - 20 ÷ 2

70 - 25 + 9 - 10

45 + 9 - 10

54 - 10

44

What is the equation of the asymptote for the functionf(x) = 0.7(4x-3) - 2?

Answers

The equation of the asymptote for the given function f(x) = 0.7(4x-3) - 2 is y = 2.8x - 4.1.

The equation of an asymptote for a function can be determined by analyzing the behavior of the function as x approaches positive or negative infinity.

For the given function f(x) = 0.7(4x-3) - 2, let's simplify it:

f(x) = 2.8x - 2.1 - 2

f(x) = 2.8x - 4.1

As x approaches positive or negative infinity, the term 2.8x dominates the function. Therefore, the equation of the asymptote can be determined by considering the behavior of the linear term.

The coefficient of x is 2.8, so the slope of the asymptote is 2.8. The y-intercept of the asymptote can be found by setting x to 0 in the equation, resulting in -4.1. Therefore, the equation of the asymptote is y = 2.8x - 4.1.

In conclusion, the equation of the asymptote for the given function f(x) = 0.7(4x-3) - 2 is y = 2.8x - 4.1.

Know more about Asymptote here:

https://brainly.com/question/32503997

#SPJ11

a land lady rented out her house for$240,000 for one year. During the year she paid 15%of the rent as income tax. she also paid 25% of the rent property tax and spent $10,000 on repairs. calculate the landlady's total expenses​

Answers

Answer: 106,000 dollars

Step-by-step explanation:

She paid 36,000 dollars as income tax and 60,000 on the rent property tax and 96,000 dollars + 10,000 dollars is 106,000 dollars.

The correct answer is 106,000 sorry if I’m wrong

Find the area of the circle. Round your answer to the nearest hundredth. diameter 3in

Answers

Area of circle = pi × r squared

A= 3.14....× (1.5×1.5)

A= 7.068583471

A= 7.07in( to nearest hundredth)

Consider a drug testing company that provides a test for marijuana usage. Among 308 tested subjects, results from 29 subjects were wrong. (either a false positive or a false negative). Use a 0.05 significance level to test the claim that less than 10 percent of the test results are wrong.

Answers

The required answer is  based on the given data, we do not have sufficient evidence to support the claim that less than 10 percent of the test results are wrong at a 0.05 significance level.

To test the claim that less than 10 percent of the test results are wrong, use a hypothesis test with a significance level of 0.05. Let's define the null and alternative hypotheses:

Null Hypothesis (H0): The proportion of wrong test results is 10 percent or more.

Alternative Hypothesis (Ha): The proportion of wrong test results is less than 10 percent.

Use the binomial distribution to analyze the data. Let p be the true proportion of wrong test results. Since we want to test that the proportion is less than 10 percent, set p = 0.10 for the null hypothesis.

Given that 29 out of 308 tested subjects had wrong test results,  calculate the sample proportion, denoted by p^, as follows:

p^ = 29 / 308 = 0.094

To conduct the hypothesis test, we can use the z-test for proportions. The test statistic is calculated as:

z = (p^ - p) / [tex]\sqrt{}[/tex]((p x (1 - p)) / n)

In this case, since we are testing whether the proportion is less than 10 percent, calculate a one-tailed z-test.

Substituting the values into the formula:

z = (0.094 - 0.10) / [tex]\sqrt{}[/tex]((0.10 x (1 - 0.10)) / 308)

Simplifying the expression:

z = -0.006 /[tex]\sqrt{}[/tex] (0.09 / 308)

z ≈ -0.006 / 0.017

Calculating the z-value:

z ≈ -0.353

To determine the critical value for a one-tailed test at a significance level of 0.05, we can consult the z-table or use statistical software. For a significance level of 0.05, the critical z-value is approximately -1.645 (since we are testing for less than 10 percent, in the left tail).

Since the calculated z-value (-0.353) is greater than the critical z-value (-1.645), we fail to reject the null hypothesis. There is not enough evidence to conclude that the proportion of wrong test results is less than 10 percent.

Therefore, based on the given data, we do not have sufficient evidence to support the claim that less than 10 percent of the test results are wrong at a 0.05 significance level.

Learn more about hypothesis testing  here:

https://brainly.com/question/30542688

#SPJ4

Find the margin of error E. A sample of 51 eggs yields a mean weight of 1.72 ounces. Assuming that o = 0.87 oz, find the margin of error in estimating p at the 97% level of confidence. Round your answer to two decimal places.

Answers

The margin of error E is approximately 0.31 oz

Margin of error is known to be a statistic expressing the amount of random sampling error in a survey's results. The margin of error informs you how close your survey findings are to the actual population's overall results. It is commonly represented by E.

The formula for margin of error is as follows:

z = critical value

σ = standard deviation

n = sample size

E = margin of error

The formula is, E = zσ/ √n

Here,

Sample size n = 51; Mean = 1.72; Standard deviation σ = 0.87 oz

Level of confidence = 97%

The level of confidence that corresponds to a z-score of 1.88 is 97% (using a standard normal table or calculator).

That is, z = 1.88 (by referring to a standard normal table or calculator)

To calculate the margin of error, we need to substitute the values in the formula

E = zσ/ √n

E = (1.88) (0.87) / √51

E = 0.3081 oz (approx)

Hence, the margin of error is approximately 0.31 oz (rounding the answer to two decimal places).

Learn more about the margin of error at:

https://brainly.com/question/32260746

#SPJ11

The diagonal of TV set is 39 inches long. length is 21 inches more than the height. Find the dimensions of the TV set a. The height of the TV set is ___ inches. b. The length of the TV set is ___ inches.

Answers

Let's assume the height of the TV set is h inches.

a. The height of the TV set is h inches.

Given that the length is 21 inches more than the height, the length can be represented as h + 21 inches.

b. The length of the TV set is h + 21 inches.

According to the given information, the diagonal of the TV set is 39 inches. We can use the Pythagorean theorem to relate the height, length, and diagonal:

(diagonal)^2 = (height)^2 + (length)^2

Substituting the values, we have:

39^2 = h^2 + (h + 21)^2

Expanding and simplifying:

1521 = h^2 + h^2 + 42h + 441

2h^2 + 42h + 441 - 1521 = 0

2h^2 + 42h - 1080 = 0

Dividing the equation by 2 to simplify:

h^2 + 21h - 540 = 0

We can solve this quadratic equation by factoring or using the quadratic formula. Factoring gives us:

(h - 15)(h + 36) = 0

So h = 15 or h = -36.

Since the height of the TV set cannot be negative, we discard h = -36.

Therefore, the height of the TV set is 15 inches.

Substituting this value back into the length equation, we have:

Length = h + 21 = 15 + 21 = 36 inches.

So, the dimensions of the TV set are:

a. The height of the TV set is 15 inches.

b. The length of the TV set is 36 inches.

Learn more about height of the TV set from

https://brainly.com/question/29205009

#SPJ11

How many kilograms are equivalent to 450 grams?
I need step by step explanation please

Answers

Step-by-step explanation:

0.45 kilograms. you decide the mass value by 1000.

pls help! correct gets thanks and brainliest :)

Answers

Answer:

[tex] m\angle SYX=76\degree [/tex]

Step-by-step explanation:

[tex] m\angle SYX = m\angle UYV[/tex]

(Vertical angles)

[tex] \because m\angle UYV=76\degree [/tex]

[tex] \therefore m\angle SYX=76\degree [/tex]

These tables represent an exponential function, find the average rate of change for the interval from x=9 to x=10.

Answers

The average rate of change for the interval from x=9 to x=10 is 39366

Exponential equation

The standard exponential equation is given as y = ab^x

From the values of the average change, you can see that it is increasing geometrically as shown;

2, 6, 18...

In order to , find the average rate of change for the interval from x=9 to x=10, we need to find the 10 term of the sequence using the nth term of the sequence;

Tn = ar^n-1

Given the following

a = 2

r = 3

n = 10

Substitute

T10 = 2(3)^10-1
T10 = 2(3)^9
T10 = 39366

Hence the  average rate of change for the interval from x=9 to x=10 is 39366

Learn more on exponential function here: https://brainly.com/question/12940982

#SPJ1

Answer:

39,366

Step-by-step explanation:

its right

Other Questions
Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment? Prepare a 5 mins PPT presentations with voice overs to the board members on the financial strength of Cool-Ice especially in financing its long-term loan. find the two x-intercepts of the function f and show that f '(x) = 0 at some point between the two x-intercepts. f(x) = x x 2 There are 20 problems in a mathematics competition. The scores of each problem are allocated in the following ways: 3 marks will be given for a correct answer. I mark will be deducted from a wrong answer and O marks will be given for a blank answer. Find the minimum number of candidate(S) to ensure that 2 candidates will have the same scores in the competition. In which of the following instances would the independence of the CPA not be considered to be impaired? The CPA has been retained as the auditor of a brokerage firmA. Which owes the CPA audit fees for more than one year.B. In which the CPA has a large active margin account.C. In which the CPA's brother is the controller.D. Which owes the CPA audit fees for current year services and has just filed a petition for bankruptcy. The dataset catsM is found within the boot package, and contains variables for both body weight and heart weight for male cats. Suppose we want to estimate the popula- tion mean heart weight (Hwt) for male cats. We only have a single sample here, but we can generate additional samples through the bootstrap method. (a) Create a histogram that shows the distribution of the "Hwt" variable. (b) Using the boot package, generate an object containing R=2500 bootstrap samples, using the sample mean as your statistic. 8 class monitors march and hoist the school flag on a Monday. They walk in a line so that every monitor except the first is preceded by another. On Tuesday, to avoid everyone seeing the same person immediately in front of them, they decide to switch positions so that no monitor is preceded by the same person who preceded him on Monday. In how many ways can they switch positions to satisfy this condition? richard walks at 5.0 mph on three days per week. on each day that he walks at 5.0 mph, he walks for 30 minutes. after each walk, richard consumes approximately 200 calories of fruits and vegetables. how many met minutes per week does richard spend walking at 5 mph? The current ratio is measured by Current assets / Current liabilities. Assume this ratio is greater than 100% (or 1:1) and that the cash balance remains positive at all times. State the effect the fol Blue Wave Co. predicts the following unit sales for the coming four months: September, 3,900 units, October, 4,500 units, November. 6,100 units; and December, 8,000 units. The company's policy is to m Example Given the supply function P=10+ vg Find the price elasticity of supply. (a) Averaged along an arc between Q=100 and Q=105 (b) At the point Q=100. The following data were collected from a sample of fathers and sons. The heights are given in inches. Construct a 95% confidence interval for the slope of the regression line. Round your answers to two decimal places, if necessary.Heights of Fathers and Sons (in Inches)Height of Father, x: 65, 67, 66, 71, 65, 70, 73, 71, 69Height of Son, y: 69, 67, 68, 73, 65, 73, 76, 73, 70