Two angle in a triangle equal 120°. What is the measure of the third angle?
a) 60°
b) 70°
c) 80°
d) 90°
e) 120°

Answers

Answer 1

Answer:

a) 60, because in every triangle, the angles always add up to 180. there are three angles in a triangle, and you k is two add to 120, so of you and 60 to 120 you get 180


Related Questions

describe fully the single transformation that maps A onto c

Answers

Answer:

They are different because they are not similar and they have different answer at the end

Find all real zeros of the function.
h(x) =-5x(x-2)(x^2-25)
If there is more than one answer, separate them with commas.

Answers

Answer:

6

Step-by-step explanation:

PLEASE PLEASE HELP ME! thank you so so much

explaining your answer = brainliest/five stars

The radius of a circle is 4 kilometers. What is the area of a sector bounded by a 135° arc?

give the exact answer in simplest form

Answers

Answer:

Step-by-step explanation:

(135/360)×π×4²

(135/360)×π×16

=6π

In a right triangle, the ratio of the length of the side opposite acute angle to the length of the side adjacent to angle is called the tangent of angle .

Answers

Answer:

The given statement is "True"

Step-by-step explanation:

The right angle triangle is shown below:

The tangent value of an angle is given by the expression as shown below:

[tex]tan\alpha =\frac{a}{b}[/tex]

A shoe store sends an email survey to all customers who pay with a debit card. The previous month, 34,000 people made debit card purchases. Surveys were sent to 2,000 of these people, chosen at random, and 256 people responded to the survey. Identify the population and the sample. The population is 34,000. The sample is 2,000. The population is 2,000. The sample is 256. The population is 256. The sample is 34,000. The population is 2,000. The sample is 34,000. The population is 34,000. The sample is 256.

Answers

Answer:

The population is 34,000. The sample is 2,000

Step-by-step explanation:

Population in statistics can be explained as the group or set of all elements which are of particular interest to a researcher or a study. In the scenario above, the research interest concerns customers who pay with a debit card, whose number amounts to 34,000, this value refers to the population. The sample is referred to as the subset of the population or larger sample, the sample from the study corresponds to number of debit card users who were selected at random to participate in the survey. This value is 2000.

PLZ HELP: Write the inverse function for the function, ƒ(x) = 1/2x + 4. Then, find the value of ƒ -1(4). Type your answers in the box.

Answers

Answer:

see explanation

Step-by-step explanation:

let y = f(x) and rearrange making x the subject, that is

y = [tex]\frac{1}{2}[/tex] x + 4 ( multiply through by 2 to clear the fraction )

2y = x + 8 ( subtract 8 from both sides )

2y - 8 = x

Change y back into terms of x with x = [tex]f^{-1}[/tex] (x) , then

[tex]f^{-1}[/tex](x ) = 2x - 8

[tex]f^{-1}[/tex](4) = 2(4) - 8 = 8 - 8 = 0

What is the solution set of the equation x2 + 2x – 15 = 0?

Answers

Answer:

( x − 3 ) ( x + 5 )

Step-by-step explanation:

HAVE A NICE DAY

Answer:

B

Step-by-step explanation:

; factor the left side of the equation

; (x−3) (x+5) = 0

set factors equal to 0

x − 3 = 0

or

x + 5 = 0

; so, x = 3  or  x = −5

9.2\times 10^{-3}-1.3\times 10^{-3}
9.2×10
−3
−1.3×10
−3

Answers

Answer:

73

Step-by-step explanation:

9.2  x 10 - 3 - 1.3 x 10 - 3

92 -3 - 13- 3

73 is the answer if that the question

Answer:

[tex](9.2 \times {10}^{ - 3}) - (1.3 \times {10}^{ - 3} ) \\ \\ = { \tt{(9.2 - 1.3) \times {10}^{ - 3} }} \\ \\ = { \tt{7.9 \times {10}^{ - 3} }}[/tex]

Anthony and Joan have $10 to buy apples and oranges at the market. They will buy a total
of 25 pieces of fruit. Apples cost 50 cents each and oranges cost 25 cents each. Which of
these systems best represents this situation?

Answers

The last one

x + y = 25 is the number of pieces of fruit they will buy, where x is apples and y is oranges.

0.50x + 0.25y = 10 applies the cost, in cents, to each piece of fruit. The 10 is 10.00, keeping everything to the same number of decimal places.

Find the missing lengths of the sides.

Answers

Answer: x = 8, y = 8

Step-by-step explanation: If 8 is already on the exterior of the triangle then this means that every angle should also be 8. But, if this were an equilateral triangle, a triangle with equal sides, then ALL sides would HAVE to be 8. But since I don't have this information (if it's equilateral or not), then I can't be positive about this. Really hope this helps you!


A whole number is 6 more than 2 times another number. The sum of the two numbers is less than 50. This can be written in an inequality as x+2x+6<50, where xrepresents the smaller number.
From the set (13, 14, 15, 16, 17), the values of x for which the inequality holds true are

Answers

Answer:

13, 14

Step-by-step explanation:

The parameters of the numbers are;

A whole number value = 2 × Another number + 6

The sum of the two numbers is less than 50

Given that the first number is equal to more than twice the second number, we have that the first number is the larger number, while the second number is the smaller number

Where 'x' represents the second number, we get;

x + 2·x + 6 < 50

Simplifying gives;

3·x + 6 < 50

x < (50 - 6)/3 = 14.[tex]\overline 6[/tex]

x < 14.[tex]\overline 6[/tex]

Therefore, the numbers for which the inequality holds true are numbers less than 14.[tex]\overline 6[/tex]. From the given option, the numbers are 13, and 14.

Which equation shows the point-slope form of the line that passes through (3, 2) and has a slope of 1/3

Answers

Answer:

y-y1=m(x-x1)

y-2=1/3(x-3)

y=1/3x+1

solver for x, trigonometric ratios

Answers

sin(45°) = 6/x
6/sin(45°) = x
8.485 = x
8.49 = x

Please help!! I have a test tomorrow and I'm struggling to answer this question
A periodic function f(x) has a period of 11. The values of f(3) and f(11) are 12 and 27, respectively. What is the value of f(14)?

Answers

Answer:

12

Step-by-step explanation:

f(14)= f (3 + 11)

= f(3) = 12

Therefore the value of f(14) is 12.

What are the dimensions of the rectangle shown on the coordinate plane?

Answers

The base is 5 units and the height is 4 units.

Hope this helps! :)

HELP ME WITH MATH PLEASEEEEE PLEASE ILL MARK

Answers

Answer:6

Step-by-step explanation:

Answer:

Your answer is right!

-130

Step-by-step explanation:

I need help to find the value please

Answers

Answer:

13.928

Step-by-step explanation:

Pythagorean theorem. 13^2 + 5^2 = x^2

Answer:

this is easy

Step-by-step explanation:

valve of x is 30 add 13 into 30 = 43÷5 5/8

¿Cómo expresarías la siguiente cantidad 1149,8x1018, en su equivalencia a notación científica?

Answers

Respuesta:
hay tres respuesta creo en el problema te los dire los tres:
Primero tu pregunta:
Cómo corregirías esta equivalencia?
1149,8 x 10¹⁸ = 1,15 x 10¹⁸
Recordemos:
-en la notacion cientifica no se aproxima, solo se reduce
-Requisito: La notacion cientifica debe estar dentro de los estandares de 1-10
sabiendo esp te dare un ejemplo y asi se te hace mas faci:
1149,8 x 10¹⁸ = 1,15 x 10¹⁸ esta es mal
1149,8 x 10¹⁸ = 114,98 x 10¹⁸ + 1 ( esto se suma xq se movio la coma a la derecha)
PSDT: esta sumando el exponente ese pequeño(yo no puedo ponerlo pequeño xd)
Bueno segun esto avanzamos hasta que cumpla el requisito
y quedaria asi:
1149,8 x 10¹⁸ esta es la forma mala
asi quedaria: 1,1498 x 10 sobre 21 ( arribita del 10 va 21)
Que procedimientos ayudaron a encontrar la respuesta?
-la multiplicacion y division
-la reduccion de numeros
-la notacion cientifica
- la formula del volumen
Porque el volumen se expresa en unidades cubicas?
porque segun se el evolumen abarca 3 dimenciones (largo, ancho y altura) y tiene que haber unamedida por lo cual se expresa en Metro cubico que
Explicación paso a paso:

Need some assistance please

Answers

Answer:I hope this could help !ut the answer is 4

Step-by-step explanation:

2 of them left so there are 4 left

I think the answer is 4

What are all numbers that equal to 30 in multiplication

Answers

Answer:

2 X 15 =30

3 X 10 = 30

5 X 6 = 30

6 X 4 = 30

10 X 3 = 30

Step-by-step explanation:

What are the domain and range of the function represented by the table?

Answers

Answer:

Doman is always the x-intercept.

And Range is always the y-intercept.

Domain = {-5, 0, 5, 10, 15}

Range = {-1, 0, 1, 2, 3}

So the answer is C.

I think the answer is C

Is it a function yes or no. 1,2,3,4,5,6.

Answers

1. no 2. no 3. yes 4. yes 5. no 6. no

Please help first correct will get brianliest. Find the value of x that makes DEF XYZ

Answers

Answer:

x = 7

Step-by-step explanation:

The larger triangle is twice as big as the smaller triangle. Therefore, the length of the side EF is twice as large as the side YZ.

I multiplied 4.5 (the length of YZ) and 2 to get 9. The value of side EF is 3x-12 and should be equivalent to 9.

3x - 12 = 9

I solved this equation by adding 12 to both sides and dividing 3 on both sides.

The value of x is 7.

Select all the solutions to the quadratic equation x2-4x-12=0

Answers

It can be factored.

We need two numbers that multiply to -12 and add to -4, so are two terms would be -6 and 2.

(x - 6) (x + 2) = 0

x = 6
x = -2

Answer:

x1= -2

x2= 6

Step-by-step explanation:

x^2-4x-12=0

x^2+2x-6x-12=0

x(x+2)-6(x+2)

(x+2)*(x-6)

one solution

x+2=0

x=-2

other solution

x-6=0

x=6

Find the volume of the triangular prism

Answers

Answer:

72 yd³

Step-by-step explanation:

Volume = Area triangle * height

Area triangle = 1/2( 8 x 3 ) =  1/2( 24 ) = 12

Volume = 12  *  6 = 72

Units = yd³

72 yd³

If my answer is incorrect, pls correct me!

If you like my answer and explanation, mark me as brainliest!

-Chetan K

After leaving her house, Shelley drove 14.47 kilometers to the gas station and then another 5.8 kilometers to work. How many total kilometers did Shelley drive to get to work after she left her house? Show your work on paper. Then, enter your answer in decimal form in the box

Answers

Answer:

20.27 km

Step-by-step explanation:

 14.47

+ 5.8

 20.27

pls help!!!!!!!!!!!!!!!!!!

Answers

Answer:

32 degrees.

Step-by-step explanation:

A triangle is 180 degrees.

180 - 85 - 63 = 32 degrees.

Answer:

x = 32

Step-by-step explanation:

All interior angles in a triangle equal to 180

use this to solve for x

180 = 85 + 63 + x

180 - 85 - 63 = x

32 = x

Easy
1/6 x 1/2x 1/3
help me ( ̄▽ ̄)╭

Answers

Answer:  1/36

======================================================

Explanation:

The numbers up top are 1,1,1. They multiply to 1*1*1 = 1. So that means 1 is the numerator of the answer.

The numbers down below are 6,2,3. They multiply to 6*2*3 = 36. This is in the denominator for the answer.

That means (1/6)*(1/2)*(1/3) = 1/36

The rule I used is (a/b)*(c/d) = (a*c)/(b*d)

Answer:

1/36

Step-by-step explanation:

Step 1:

1/6 · 1/2 · 1/3       Equation

Step 2:

1/6 · 1/6          Multiply

Answer:

1/36

Hope This Helps :)

Find the volume of the sphere.
Either enter an exact answer in terms of π or use 3.14 for π and round your final answer to the nearest hundredth.

Answers

Answer:

Volume of a sphere = 4πr³/3

r=10

V = 4πx10³/3

=4000π/3

V= 1333.33π (in terms of pi)

or

V= 4188.79(Nearest Hundredth).

314 or 100pi cause u do 10 squared multiplied by 3.14

Explica qué significan las variables "m" y "b" en la ecuación y = mx +b*

Answers

Answer:

La M representa la pendiente de la recta y la b representa la intersección con el eje y

Step-by-step explanation:

Que tengas un excelente verano :)

Respuesta: En la ecuación y= mx + b, “m” representa la pendiente y “b” representa el y-intercept.

Espero que esto ayude, buena suerte! :D

Other Questions
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7 compare and contrast the Nationalist Party with the Chinese Communist Party. Can you guys help me find the answer PLZ HELP ASAP!!!!!!!!!!!!!! A store has two different coupons that customers can use. One coupon gives the customer $15 off their purchase, and the other coupon gives the customer 30% off of their purchase. Suppose they let a customer use both coupons and choose which coupon gets applied first. For this context, ignore sales tax.Let f be the function that inputs a cost (in dollars) and outputs the cost after applying the "$15 off" coupon, and let g be the function that inputs a cost (in dollars) and outputs the cost after applying the "35% off" coupon. a. Suppose acustomerwants to purchase asi 40 item and apply the si 5 of coupon first, and then the 35% or coupon How much will the item cost after applying the coupons?b. Suppose a customer wants to purchase a S 140 item and apply the SI 5 off coupon first, and then the 35% or coupon Ure ction notation to represent how much the item will cost (dollars) after applying the coupons. c. Suppose a customer wants to purchase a $140 item and apply the 35% om coupon first and then the sis of coupon How much will the item cost after applying the coupons?d. Suppose a customer wants to purchase a S 140 item and apply the "35% or coupon first and then the "S 15 off coupon. Usefu ction notation to represent how much the item will cost (dollars) after applying the coupons. Population, 1860-1920Year Percent Rural Percent Urban186080.219.8187074.325.7188071.828.2189064.935.1190060.439.6191054.445.6192048.851.2Which of the following statements is TRUE about the information displayed in thetable above?Between 1860 and 1880, rural population increased.Between 1860 and 1920, people began moving to cities.Between 1910 and 1920, rural and urban populations were even.D Between 1860 and 1920, urban and rural populations remained stable. A corporation declares a cash dividend on Friday, December 5th, payable to holders of record on Friday, December 19th. The local newspaper publishes the announcement on Monday, December 8th, while Standard and Poor's reports the dividend on Friday, December 12th. The ex date for regular way trades will be set at: A Friday, December 5th B Wednesday, December 17th C Thursday, December 18th D Friday, December 19th our situation is ____ to the problems the warehouse staff dealt with last year. analogous, opposite, incongruous, conducive, symmetrical Please help, show work! Limits and functions! 85 points! Answer for fee rbux and branlest!!!! i need answer NOW or i will be DIE (not good!!!) 61 1/20 as a decimal The length of a rectangle is six times its width.If the perimeter of the rectangle is 84 in, find its area. what is the range of 20,15,10,5 Find the approximate surface-area-to-volume ratio of a bowling ball with a radius of 5 inches.A 0.6B. 0.67C. 1.67D. 25 A bakery celebrated its 25th anniversarylast Friday. On that day, every 12thcustomer received a free loaf of breadand every 9th customer received a freecupcake.Lauren was the first customer to receivea free loaf of bread and a free cupcake. What was Lauren's number? please help with the steps How would I figure this out?