What is the distance between (2, -1) and (-1, -5) on the coordinat plane?

a. 7 units
b. 6 units
c. 5 units
d. 4 units

Answers

Answer 1

Answer:

D

Step-by-step explanation:

Answer 2
i think 4 units so d


Related Questions

Eight pipes were turned on to fill the pool in 36 hours. Then, after 12 hours some of the pipes were turned off, and the rest of the pool was filled in 32 hours. How many pipes were turned off?
Please show your work

Answers

Answer:

4 pipes (im pretty sure)

-but i hope this was correct and if not i hope it at least helped have a good rest of your day :)

Step-by-step explanation:

because 36 - 32= 34

6 or 7 i would think. hope that helps.

Which group of numbers is listed from least to greatest?

A. 5, 3, 2, -6, -8
B. -7, -4, -2, 1, 5
C. -2, 3, -4, 5, -7
D. -2, -3, -5, 0, 4

Answers

Answer:

The answer should be B

Step-by-step explanation:

The answer is B. Since it starts in the greater negative number than the others.

PLEASSEEEE HELPPPP!!!!!

Answers

Answer:

-3, -1

Step-by-step explanation:

HELP ME I DONT UNDERSTAND

Answers

Its A because the ratio from females to males ls 5:3

Answer:

B. He should focus on females because the ratio of females to males is 5:2.

Step-by-step explanation:

By looking at the graph, you can see that there are 25 females and 10 males. The ratio for this is 25:10, but we can simplify by dividing both sides by 5! 25/5=5, and 10/5=2, so the simplified ratio of 25:10 is 5:2. If you look at all of the answer choices, you really don't have to look at the words a lot; there's only one choice that includes the ratio 5:2. That choice is B, so B is the answer!

Hope this helps you out!! Have an amazing day o(*^▽^*)o

answer this please please pls ya

Answers

Answer:

A

Step-by-step explanation:

took the test

The dog knows it should not be traveling at this time, but follows his owner. Would this be an example of an internal or external conflict? Why?

Answers

Answer:

internal conflict

Step-by-step explanation:

bc the dog cares about his owner but he also knows he shouldn't b traveling rn so its a problem within him. Hope this helps

Internal conflict because the dog wants to be with his owner there for follows him

Nicholas has some cans at home to donate to the soup kitchen, but decides to start a can drive at his school to see if others will help. The equation representing this is y = 235x + 15, where x is the number of days, and y is the number of cans collected. Which statements are true based on the equation given. Select all that apply.


A Nicholas had 235 cans at home.
B The school collected 235 cans a day.
C Nicholas had 15 cans at home.
D The school collected 15 cans daily.

Answers

Answer:

It is A and D Right?

Step-by-step explanation:

C) Nicholas had 15 cans at home

Please help me answer this question.

Answers

18c - 30d + 36
hope it helped

plz help I need this now

Answers

Answer: 1 30.0

3 20

2 8

Step-by-step explanation:

Karen earns $5 by delivering newspapers each week. She saves $3 and she spends the rest. How many weeks will it take her to save enough money to buy a $35 gift card? (Use the table to help you solve the problem; you will need to copy it onto a piece of paper

Answers

It will take her 12 weeks overall

Answer:

i got 2.5 weeks

Step-by-step explanation:

you subtract 5-3=2 so she saves 2$ every day.So divide 35 to 2 and get 17.5.

then divide 17.5 from 7 days and get 2.5weeks

I THINK!

Identify the pattern rule for this sequence: 2, 8, 7, 13, 12, 18, 17…
multiply by 4, divide by 1
add 6, subtract 1
add 5, subtract 1
multiply by 4, subtract 1

Answers

I may be wrong but I think add 6 subtract one

ILL MARK BRAINLIST please answer asap

Answers

Answer:

what's the question????

Step-by-step explanation:

Answer:

what do you need help with

Step-by-step explanation:

Solve the following expression: (36 + 14) ÷ 10 . Show all the steps taken. *

Answers

Answer:

(36 + 14) ÷ 10 = 5

Step-by-step explanation:

Using PEMDAS we have to simplify the parentheses first. 36 + 14 is 50. Next we have to divide. 50 ÷ 10 is 5. The answer to (36 + 14) ÷ 10 = 5.

If this helped I would appreciate it if you marked me brainliest. Thank you and have a nice day!

Answer:

First finish the brackets

36+14=40

40/10

4

Step-by-step explanation:

I hope this is all the step you need

whAt rate describes it

Answers

Answer:

the amazing rate

Step-by-step explanation:

1/2

Answer:

the answer is a

Step-by-step explanation:

because the amount of cups is 1/2

the amount of servings is 2/3

Pentagon M’N’P’Q’R’ is larger than pentagon MNPQR, because the scale factor is greater than 1.

Pentagon M’N’P’Q’R’ is smaller than pentagon MNPQR, because the scale factor is less than 1.

Pentagon M’N’P’Q’R’ is smaller than pentagon MNPQR, because the scale factor is greater than 1.

Pentagon M’N’P’Q’R’ is larger than pentagon MNPQR, because the scale factor is less than 1.

Answers

Answer:

Pentagon M'N'P'Q'R' is smaller than pentagon MNPQR, because the scale factor is less than 1.this should be an answer choice

Step-by-step explanation:

Uhhh pls help. I know that A is not it.

Answers

The answer is B, because those ones are similar
I would say the answer is B.

The average yearly precipitation for Gulfport,
Mississippi, is 65.3 inches. About how much precipitation
does the area receive each month? Explain why your
answer is reasonable.
(brainliest included for correct answer)​

Answers

5.441 inches every month I’m pretty sure

Suppose that y is directly proportional to x, and y = −16 when x = −2. What is the constant of proportionality?

A) −8
B) −
1
8
C) 1
8
D) 8

Answers

Answer:

In the given expression the constant of proportionality is  k = 8.

Step-by-step explanation:

The quantity P is said to be directly proportional to Q if they vary in proportion to each other.


Here, P ∝ Q ⇔  P = kQ : k = Proportionality Constant


Now, here given y ∝ x   and x =  -2, y = -16

Now, y ∝ x ⇒  y =  kxor, (-16)   = k (-2) or, k = 16/2  = 8 ⇒ k = 8So, for k = 8, y ∝ x 

Hence, in the given expression the constant of proportionality is  k = 8.

pls help i only have 2 minutes!!!!!!!!!!!!!!

Answers

Answer:

40 + ( -63) is less

Step-by-step explanation:

.... .....

Answer:

(-25)+12

=13

40+(-63)

=23

Setting 7 / 3 equal to which ratio would result in a valid proportion? a.9 / 49 b.18 / 42 c.42 / 18 d.49 / 9

Answers

I believe the answer is C, but please correct me if I’m wrong!

30 points if you aswer this[tex]\frac{1}{3}x \frac{3}{4} x\frac{4}{5}[/tex]

Answers

Answer:

1/5

Step-by-step explanation:

1/3 x 3/4 x 4/5

1/3 x 3/4 = 3/12

3/12 x 4/5 = 12/60

12/60 = 1/5

The answer is = 12/60

solve the proportion. where necessary, round to the nearest hundredth. 8/2 = x+3/4

Answers

Answer:

x = 13

Step-by-step explanation:

8/2 = (x + 3)/4

~Simplify

4 = (x + 3)/4

~Multiply 4 to both sides

16 = x + 3

~Subtract 3 to both sides

13 = x

Best of Luck!

Michael decided to make French toast. He finds a recipe that calls for the following ingredients:

FRENCH TOAST
12 slices of bread
4 eggs
1 cup of milk
1 teaspoon of cinnamon

Michael makes a single recipe and shares the food equally among himself AND his four family members. How many slices of French toast does each person receive?

A.Each person gets 2 2/5 slices of French toast.
B.Each person gets 1/2 slice of French toast.
C.Each person gets 2 slices of French toast.
D.Each person gets 12 slices of French toast.
E.Each person gets 5 slices of French toast.
F.Each person gets 5/2 slices of French toast.

Answers

Answer:

The answer is "A" because you would have everyone get 2 pieces and you would give everyone 2/5 which would evenly divide 12 pieces

Im pretty sure it is A! But I still could be wrong. PLease forgive me if im wrong but I tried my hardest. If Im wrong pls correct.

(if correct could I maybe have brainliest? Tysm!)

Thats all. LOL cya

btw don't cheat anymore

                  WINK WINK WINK

lol

All of last year’s car models were marked down 40%. Tracy wants to buy a car on sale for $18,000. What was the retail price of the car?

Answers

25,200 is the retail price of the car. 18000 + (40% = 7200) equals to 25,200.

Answer:

25,200.

25,200 is the retail price of the car. 18000

+ (40% = 7200)

equals to 25,200.

(+1) + ? + ? + ? = (-1)

Answers

Answer: ? = -1, -1, 0

Step-by-step explanation:

cause its positive and you would need to get it to a negative

someone help me please

Answers

Answer:

A. Length= 1.5 inches

width= 2 inches

B. 15

Step-by-step explanation:

seems the question has been answered already 15

PLEASEEEEEEEEE helpp I really need this answer so I can get a 100% pleaseee

Answers

Answer:

5^-5

Step-by-step explanation:

Answer: I am pretty sure the answer is 0.00032.

what is 11/15 +[-7/12 = ?

Answers

Answer: 3/20

Step-by-step explanation:

11/15+(-7/12)=3/20 hope it helped

Reflection/Math please help

Answers

Answer:

Step-by-step explanation:

A' = (-4, 1)

B' = (-7, 2)

C' = (-2, 8)

D' = (-2, 3)

what the other guy said

Please help me understand how to work out these types of equations?
My teacher isn't doing a very good job at it right now.

Answers

Answer:

48

Step-by-step explanation:

2.4 (12 / 1/4)

First you do distributive property (multiplying the number in front of the parenthesis).

28.8 / 0.6

Then you just do the math

48

It's pretty easy, but it just depends on how somebody explains it.

Other Questions
Triangles have a total of 180. Use the triangle below to determine the value of X. What are five ways companies target teens and vaping? What is the slope of the line that passes through the points (-8, 6) and (-5, -3) Find the product of 3 1/5 and 5/8. Express your answer in simplest form Which statement from The Number Devil best reveals that the author is using the number devil's character to promote a positive view of mathematics? "Most genuine mathematicians are bad at sums. Besides, they have no time to waste on them. That's what pocket plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason According to the following reaction, how many grams of sulfur are formed when 37.4 g of water are formed? 2HS(g) + SO(g) 3S(s) + 2HO(l) Explain reasons for 13 colonies 2. What are the two types of deeds that make up the hero's journey? what plan has been made for the HRD in nepal? I do not breathe, but I run and jump. I do not eat, but I swim and stretch. I do not drink, but I sleep and stand. I do not think, but I grow and play. I do not see, but you see me every day. What am I? Both pieces of writing attacked the practices of the Catholic Church. Yet one led to a complete break, while the other did not. What in Luthers words seems uncompromising, and what in Erasmus words leaves more room for reform? What is the main function of the small intestine?(use terms : villi, surface area,blood capillaries,why must large molecules be broken down, high concentration and low concentration.) can anyone just explain how to do a distant rate time problems because I'm confused about them