which of the following is an accurate title for the outline?

Which Of The Following Is An Accurate Title For The Outline?

Answers

Answer 1

Answer:

I'm 80% sure that it's D

Explanation:


Related Questions

what is The main job of the Supreme Court?

Answers

Answer:

To identify the guilty and give justice to innocent

Answer:

The following are the Supreme Court functions:.

Explanation:

a) The SC gives the final verdict against an appeal from the other subsidiary courts i.e., High courts.

b) It acts as an institution where issues from the different governmental bodies, central government, and the state government matters are resolved.

what was the result of Pontiac’s Rebellion

Answers

Pontiac’s Rebellion lead to Great Britain’s Proclamation of 1763, which proclaimed that colonists were barred from settling west of the Appalachians. This would be an attempt to reduce conflict between native Americans and white settlers.

Which term means
a division or part of the Constitution?
A. article
B. item
C. concept
D. means

Answers

It’s a article
Another name is article of confederation

Which term means a division or part of the Constitution?

[tex]\sf\purple{A.\: article}[/tex] ✅

[tex]\bold{ \green{ \star{ \orange{Mystique35}}}}⋆[/tex]

Why was Princeton significant in the revolutionary war in 1776​

Answers

Answer:

I think the effect of the Battle of Trenton and the Battle of Princeton was to clear most of New Jersey of British troops. The battles impressed upon the European powers that the Americans were able to confront the British Army and the decisive intervention of France and Spain in the Revolutionary War came a step closer.

Hope it help you!:)

iiidjdjfjfjdjndndjxixjxjn

Answers

Answer:

iiidjdjfjfjdjndndjxixjxjn

Explanation:

because of iiidjdjfjfjdjndndjxixjxjn made iiidjdjfjfjdjndndjxixjxjn want to go to iiidjdjfjfjdjndndjxixjxjn, so he ended up going to iiidjdjfjfjdjndndjxixjxjn insetad of iiidjdjfjfjdjndndjxixjxjn.

Compare and contrast Presidential Reconstruction with Congressional Reconstruction, including the significance of Lincoln's assassination and Johnson's impeachment.​

Answers

Answer:

Explanation:

While Lincoln took a moderate approach to Reconstruction, Congress sought to impose ... President Johnson proved to be an obstacle to the Radical Republicans in Congress, ... assassination, attempted to continue Lincoln's vision for Reconstruction.

What was one significant difference between industrialization in japan and industrialization in the United States?

Answers

industrialization came to Japan as a result of foreign aggression. In the united states it was to get richer

3. What is the United Nations Security Council? Who are the permanent members

Answers

Answer:

Explanation:

The permanent members of the United Nations Security Council (also known as the Permanent Five, Big Five, or P5) are the five sovereign states to whom the UN Charter of 1945 grants a permanent seat on the UN Security Council: China, France, Russia, the United Kingdom, and the United States.

Answer:

Explanation:The permanent members of the United Nations Security Council (also known as the Permanent Five, Big Five, or P5) are the five sovereign states to whom the UN Charter of 1945 grants a permanent seat on the UN Security Council: China, France, Russia, the United Kingdom, and the United States.

what geographic feature
led to japan expansion

Answers

Possibly their location in asia. They were on an island and lacked many natural resources.


This man wrote many plays about love, death, and other humanist ideas.

Answers

its defo Shakespeare right?

Which statement best describes the governments of the city-states?
The city-states voted on which city-state would lead the rest.
Each city-state was independent and had its own form of government.
The city-states were all part of one empire with the same government,
* All city-states had a similar form of government, since they were located near one another.
ly

Answers

Answer:

The correct answer is B

Explanation:

just did the assignment a week ago.

The final movement of beethoven's seventh symphony includes an enormous finale inspired by Friedrich von Schiller's ode to universal brotherhood, the Ode to Joy.

a. True
b. False

Answers

Truth if I’m wrong I’m sorry

The final movement of Beethoven's seventh symphony includes an enormous finale inspired by Friedrich von Schiller's ode to universal brotherhood, the Ode to Joy. This statement is false.

What is Brotherhood?

Brotherhood broadens your understanding of what matters most in life and strengthens what you learnt growing up. When you belong to a fraternity, you can learn from other guys how to lead, date, plan for a future family, improve in his work, and manage his finances.

Brotherhood can be viewed as a partially organized social relationship based on membership and encouraged and facilitated by regulation, despite the fact that organizations are important for fostering fraternal ties.

Hence, The final movement of Beethoven's seventh symphony includes an enormous finale inspired by Friedrich von Schiller's ode to universal brotherhood, the Ode to Joy. This statement is false.

To know more about Brotherhood follow the link.

https://brainly.com/question/4407332

#SPJ2

What was the significance of Shays' Rebellion?
Group of answer choices

It demonstrated the power of the presidency.

It demonstrated the flaws of the federal government under the U.S. Constitution adapted in 1787

None of the above.


It demonstrated the power of the national army.

It demonstrated that the Continental Congress under the Articles of Confederation was weak and unable to respond to crises in an effective manner.

Answers

Answer:

The last one I think. (The continental congress was unable to respond to crises) Sorry if it's wrong.

Which of the following actions may Congress take to advance civil rights?

Answers

Answer:

The debate over these issues that began in the late-nineteenth century continues, In The Civil Rights Cases (1882), the Supreme Court struck down, that the Fourteenth Amendment, by its very terms, prohibits only state action.” the view that Congress can use its power under Section Five to expand rights.

Explanation:

What role were women permitted to play in the Enlightenment?

Answers

Answer:

The Enlightenment came to advance ideals of liberty, progress, and tolerance. For those women who were able to discuss and advance new ideals, discourse on religion, political and social equality, and sexuality became prominent topics in the salons, debating societies, and in print

Answer:

They were able to discuss and advance new ideals, discourse on religion, political and social equality, and sexuality became prominent topics in the salons, debating societies, and in print. [ -were women permitted to play in the Enlightenment.

What event helped unite East and West Germany?
A. The Velvet Revolution
B. The Solidarity protests
O c. The fall of the Berlin Wall
D. The policy of glasnost

Answers

Answer:

C The fall of the Berlin wall

The fall of the Berlin Wall helped unite East and West Germany. The wall had been a symbol of the division between the two countries since it was constructed in 1961. Thus, option C is correct.

What was the fall of the Berlin Wall?

The fall of the Berlin Wall refers to the peaceful dismantling of the barrier that divided East and West Berlin during the Cold War. The Berlin Wall was a physical barrier that separated East Germany, which was under Soviet control, from West Germany, which was a democratic country allied with the United States and other Western nations.

The wall was built in 1961 to prevent East Germans from fleeing to the West, and it became a symbol of the Cold War and the division of Europe. The fall of the Berlin Wall began on November 9, 1989, when the East German government announced that citizens could cross the border into West Germany.

This led to a spontaneous celebration and a flood of people crossing into the West. Over the following weeks, East and West German officials negotiated the opening of the border crossings, and eventually the wall was dismantled. The fall of the Berlin Wall marked the end of the Cold War and the beginning of the reunification of Germany.

Learn more about fall of the Berlin Wall here:

https://brainly.com/question/27624975

#SPJ7

Which of the following best describes the philosophy of the British in colonial matters? [Select all that apply.]

—paternalistic
—anarchy
—hands-off
—direct rule

Answers

Answer:

Paternalistic Hands-off

Explanation:

The British usually pursued or at least tried to pursue a paternalistic model of rule in their colonies where they tried to develop their version of civilization whilst putting down cultural practices that they deemed backwards in the hope that the colonies would develop.

In order to reduce the cost of governance, they also practiced a hands-off philosophy where direct rule was left to local leaders who were then accountable to the British local administrators.

Please hurry...
Approximately how many soldiers died during World War I?
A.
200,000
B.
1 million
C.
10 million
D.
100 million

Answers

well it’s 20 mill but that’s not really an option so i would go with 10 mill

Is the film based on a book? Who kill Malcolm x

Answers

Answer:

Thomas Hagan (/ˈheɪɡən/; born March 16, 1941) is a former member of the Nation of Islam and one of the assassins who killed Malcolm X in 1965.

Explanation:

the real name for Mother Theresa was​

Answers

Answer:

Anjezë Gonxhe Bojaxhiu

Answer:

Anjezë Gonxhe Bojaxhiu is the name that Mother Teresa was born with

Explanation:

Which was not an outcome of the New York City draft riots of 1863?

Group of answer choices

1. Tammany Hall helped poor immigrants avoid the draft.

2.The North surrendered because it didn't have a large enough army.

3.President Lincoln reduced the amount of people from New York drafted.

4.African-Americans fled the city permanently.

Answers

Answer:

#2 is the correct answer!

Explanation:

The North WON the civil war, and they never surrendered. It was the South that surrendered!

In this, the North surrendered because it didn't have a large enough army was not an outcome of the New York City draft riots of 1863. The correct option is (2).

What do you mean by the New York City draft riots of 1863?

The New York Draft Riots were five days of some of the bloodiest and most damaging rioting in American history that took place in July 1863 as a result of the ire of working-class New Yorkers over a new federal draught law during the Civil War.

The primary recruiting center in New York was destroyed by a crowd when army recruitment started in July 1863.

Then, over the course of three days, large groups of white workmen marched across the city, tearing down homes, factories, buildings, and streetcar lines.

The anti-Black, anti-rich, and anti-Republican aspects of the conscription riots were multifaceted.

Therefore, in this the North surrendered because it didn't have a large enough army was not an outcome of the New York City draft riots of 1863.

To know more about the New York city draft riots of 1863, visit:

https://brainly.com/question/29392853

#SPJ2

Drag each incentive to the correct location on the chart.
Nick has been hired as the marketing director of a sporting goods manufacturing company. Classify his new job incentives as monetary or nonmonetary.
salary increase
flexible work schedule
commission on every sale
stock options
reduced work hours
friendly coworkers

Answers

Answer:

Monetary incentives have to do with cash compensation whereas non-monetary incentives do not include cash but rather work on providing a fulfilling experience for the employee. Research indicates that both are necessary for job satisfaction.

Monetary Incentives

Salary increaseCommission on every saleStock options.

Non-monetary incentives

Flexible work schedule Reduced work hours Friendly coworkers.

In the opening sentence Lincoln refers to the founding of the nation four score and 787 years later which of the following best explains Lincoln‘s purpose in this opening

Answers

Answer: b. He wanted to remind people about what the nation’s founding ideals were.

Explanation:

In 1863 President Lincoln delivered one of the most iconic speeches of all time known as the Gettysburg address as he opened the Gettysburg cemetery which was constructed for dead Union soldiers during the Civil War.

He began the address by referring to the founding of the nation 87 years in the past the purpose of which was to remind people why the Founding Fathers founded the United States and the ideals they did so with.

He wanted people to remember that the United States was founded on the principles of liberty for all people and not just people of a certain race with the aim being to justify the Civil War and its goal of ending slavery.

During WWII the US government did the following EXCEPT

A. Allow women to stay out of the workforce.

B. Relocated hundreds of thousands of Japanese Americans to internment camps.

C. Relied on media personalities and comics to promote war programs and restrictions.

D. Encouraged rationing and the growing of victory gardens.

Answers

Answer:
The answer is D

Pls look at the picture and answer the question

Answers

Hello!

For me the right answer is :

" a conclusion that is powerful, memorable, and sums up your position "

But take your time and don’t go more than your time limit :3


Byye and don’t forget I’m proud of you!!<33

Bolshevik Party*

O the Communist Party in the Russian revolutionary period

O The first name for the German National Socialist Party

O The Opposition Labor Party in the United States

O None of the above

Answers

Answer:

the Communist Party in the Russian revolutionary period

Explanation:

Question 19 of 25
Which of these best describes the conditions faced by freed African
Americans who moved to big cities in the North?
O A. Self-sufficient farms
O B. High-paying jobs
C. Integrated schools
O D. Segregated housing

Answers

Answer:

D.Segreated Housing

Explanation:

why?Cause racism.

What did the Compromise of 1850 show?

A. the issue of slavery was becoming a larger problem

B.popular sovereignty would not work to settle the slavery issue

c. the people of California wanted their state to become a slave state

D. Americans were unable to resolve their differences​

Answers

Answer:

A.  the issue of slavery was becoming a larger problem

Explanation:

In the end, initiatives such as the Compromise of 1850 helped to actually worsen the North and South antagonisms and might have done more harm than good in starting the Civil War in that it could not resolve the issue of slavery in a finalized way.

5 things that allows the United States to expand geographically from 1790 to 1860.

Answers

Answer:

Louisiana purchase, Adams'Onis treaty, Mexican cession, gadsden purchase, and the Trety of Oregon (gets Oregon)

Explanation:

i read it from the top of my head! no internet searching for me!

2. France was destroyed and suffered heavy losses due to Germany's use
of the Blitzkrieg strategy against it.*
O True
O Fasle

Answers

i’m not going to pretend to answer i’m just going to leave this comment but i do think that the answer is true
Other Questions
what happens when you divide by 0? i did this problem in my calculator and it broke.69 + 420 divided by 0 Which of the following has a direct influence on Congress and the President?all of the abovevotersPACsinterest groups****** Consider an event you are familiar with, such as a baseball game, a rock concert, or delivering delivering product to a customer. Map out the logistics tasks needed and their sequence in organizing this particular event. Pls someone help me these's problem's! Can yall help me?! :) An unstretched ideal spring hangs vertically from a fixed support. A 0.4 kg object is then attached to the lower end of the spring. The object is pulled down to a distance of 0.35 m below the unstretched position and released from rest at time t= 0. A graph of the subsequent vertical position y of the lower end of the spring as a function of t is given above, where y= 0 when the spring was initially unstretched. At which time is the upward velocity of the object the greatest? Out of the people who have already taken their seats at a seminar, 2 people have black hair while 2 people do not. Considering this data, how many of the next 16 people to take their seats should you expect to be black-haired? Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts Whoever answers these 2 right gets brainliest and 25 points! please help me :(Any Maths Moderator:( please help me; I am in great trouble I need help with another too! :( I will mark brainliest! You will get 30 piontsthe picture is right there too! The question is also in the picture too!I hope you could see it clrealy! Find the value of x. 0.45 written as a common fraction, in its simplest form, is Step by step pls thanks 1. Mention naste to any four importance of animals plants Write 5/14 with denominator 28 Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5.