Which of the following
statements about Edmund
Spenser is true?
A. He changed the way we treat poetry.
B. He was chased out of England by
Puritans.
C. His sonnets are about unrequited love.
D. His collection of sonnets is called
"Rigoletto".

Answers

Answer 1

Answer:

ummmmmmmmmmm

Explanation:

Answer 2
D his collection of sonnets is called rigoletto

Related Questions

So far, what seems to be the function of Clarisse within the novel
Fahrenheit 451?

Answers

Answer:

Clarisse's function in the novel Fahrenheit 451 is that of a devil's advocate in a way, and even a prod that gets Montag thinking more about the world he lives in. She causes Montag to question the stark reality of the morally bankrupt world in which he lives. ... She asks questions.

Explanation:

How does the Author convey the theme of identity for “Music for my mother”?

Answers

Answer:

The author conveyed the theme of identity when he showed how the family who were originally Spaniards adjusted to life in the United States of America.

Explanation:

The theme of identity conveys the thought of who a person is and how he efficiently thrives in the environment he finds himself in. For the Spanish family in the story, the mother struggled to relinquish her native Spanish identity for the American one. This is why she still preferred her songs in Spanish and would rather communicate with her husband in their native language.

The boys and their father on the other hand made conscious efforts to adjust to the new life in America. They learned the language, adjusted their sense of dressing, and learned to live in a fast-paced environment. Even Pedrito changed his name to Peter. The family could adequately identify as U.S citizens as they built their career, and had their families there.

Select one of the readings in this unit and in at least 150 words, discuss the author's use of figurative language, also known as figures of speech, literary devices, and rhetorical devices. Identify and discuss the explicit and implicit meaning of at least three kinds of figures of speech.

Answers

Answer:

On her zoo blog, bindi describes the experience of walking the red carpet with her mum that evening, and the unmatched joy of what happened soon after. “all the categories came up, but then mine did! they said all these top actresses' names then my name! the guy said 'and the winner is . . ’ . . my heart stopped . . ‘bindi irwin! ’ i could not believe it, i won! i was amazed, in tears, i could hardly talk! i’ll never forget that great trip! ” what does the hyperbole in the excerpt the reader understand about bindi? she had a medical problem. she was extremely frightened. she became very excited. she won an important award.

PLZZ HELPP IM FAILLING THIS CLASS

Answers

Answer:

Usage

Explanation:

because usage is how you use words in writing or speaking, if you use them wrong you can cause misunderstandings. That is why they must be used or utilized correctly.

Why does the Herdsman beg Oedipus to allow him to be silent?

Answers

Answer:

He begs him to be silent because he knows once Oedipus happened to find out, all hell would break loose.

Explanation:

HOPE THIS HELPS:)

how is the mice and Lennie similar to each other, in of mice and men?

Answers

Of Mice and Men Essay Lennie needs George more than George needs Lennie. Both Lennie and George would be nothing without each other. Steinbeck clearly shows how important friends are and how they can support and help you in a number of different ways. Lennie needs George for basic survival and without him, Lennie’s life would not be very long.

Answer:

They are both treated the same, like how a dog gets treated by it's master, Lennie does too.

Explanation:

I make your CHRISTMAS tree beautiful, WHAT IS THAT CALLED? IT IS A 9 WORD. PLEASE HELP I BEEGED OU WILL MARKED BRAINLIEST

Answers

Answer:

Ornaments

Explantion: Hope this helps!

A theme about freedom in the book refugee

Answers

Answer:

, it is a story about what unites us all… love, family and perseverance.

Explanation:

If there is no author's name available, how do you handle an in-text citation?

Answers

Answer:

i believe you would use a shortened title of the work instead of an authors name

Explanation:

what are the limitations of having nick serve as the narrator of this story? How does chapter 2 make this limitation obvious?

Answers

Answer:

The limitations of having Nick as a narrator is that the readers are not able to know the thoughts of other characters. In First-person narrative, readers get to know only what narrator knows and what he sees and perceives about the event.

The evidence of this limitation in chapter is apparent when Nick gets drunk and he himself claims that his drunkness has a  dim hazy cast over it.

Explanation:

The Great Gatsby is a novel written by F. Scott Fitzgerald. The novel is about Jay Gatsby and is narrated by Nick Carraway.

The story is narrated from First-person point of view. The limitation of having Nick as a narrator is that readers are not able to perceive the thoughts of other characters, especially that of Jay Gatsby. The readers get to know only what limited view of Nick narrated to them. They are able to see only what Nick sees and nothing beyond it or other's viewpoint. It is the viewpoint of Nick that moulds the story of Gatsby.

This limitation is apparent in Chapter 2 of the novel when Nick gets drunk at the party and himself admits that his drunkness has a  dim hazy cast over it. This suggests that Nick was not able to trust his own narration of this particular event after he got intoxicated.

what feelings may the bully experience?

Answers

Answer:

?

;/

Explanation:

he may feel good about himself to bully someone else
he may feel like he’s cool
he may feel mad and angry and that’s why he’s bullying

need a 5 paragraph essay on climate change

Answers

Answer:

Questions:

1.      What happened to the amount of carbon dioxide in the atmosphere from 2010–2017? By looking at the graph, I can tell it went up by about 2 (ppm) per year. In 2010 it was 390 ppm and by 2017 it was up to 406 ppm.

2.      How did the global temperature change from 2010–2016? By looking at the graph, I can tell it went up from 0.71 degrees (C) in 2010 to 0.99 (C) degrees in 2017

3.      What is the relationship between the amount of carbon dioxide in the atmosphere and global temperature? The amount of CO2 in the atmosphere directly affects global temperature, because the CO2 gets trapped in the atmosphere.

4.  How have humans contributed to the rise in global temperatures over the past century? Humans have contributed to the rise in global temperatures by burning fossil fuels. This happens when the process of burning coal or oil combines carbon with oxygen in the air to make CO2, which is a greenhouse gas that pollutes the air.

5.      What natural processes have affected global temperatures? According to Nasa’s Earth Observatory, “two major volcanic eruptions, El Chichon in 1982 and Pinatubo in 1991, pumped sulfur dioxide gas high into the atmosphere. This is an example of natural processes affecting the global temperature.  The gas was converted into tiny particles that lingered for more than a year, reflecting sunlight and shading Earth’s surface.”

This is just one way humans have affected global temperature.

Explanation:

Answer:

thanks for the points

Explanation:

uwhjrnwjw✌‍‍‍‍✈️‍‍‍‍‍‍‍✈️‍✈️‍♂️‍♂️‍♀️‍♂️‍♀️‍♀️‍♀️‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍‍☺☺☺

In “To His Coy Mistress," what else besides being coy does the speaker imply about the mistress?
A- she is beautiful
B-she is impatient
C-she is unromantic
D-she is kindhearted

Answers

(A) she is beautiful
She is kindheard of everything

the art of cave dwellers was crude and ____

Answers

Answer:

Because I searched this question up on Google, the only answer i can come up with is "Crude and mimetic" I really hope this helps!

the second step in the writing process is revising.
is it true or false

Answers

Answer:false

Explanation: the second step is drafting

Answer:

False

Explanation:

That's the 4th step.

Please help me, I’m confused

Which sentence states the main idea of the paragraph?

A.) The topic sentence, which indicates that Coit Tower is both interesting and little known

B.) the topic sentence, which indicates that Coit Tower was built on a hill

C.) the supporting sentence that states that the tower was built as a memorial to Lillie Hitchcock Coit

D.) The supporting sentence that states that many murals were painted on the tower's walls

Answers

Answer:

A is the is answer

Explanation:

The screenshot below verifies my answer to be correct.

Answer:

A

Explanation:

the challenges britain faced in going to war????

Answers

Answer: if you’re referring to the revolutionary war, britain was fighting a distant land. They had to ship supplies and soliders basically across the world.

Explanation:


3) As used in paragraph 2, which is the best antonym for complex?
A. impressive
B. beautiful
C. exciting
D. simple

Answers

Answer:

D. simple

Explanation:

As used in paragraph 2, the best antonym for complex is simple.

Complex is known to be a system of different things which are linked or connected in a close or complicated way. Antonym means the opposite of something. So, the opposite of complex as used in paragraph 2 is "simple".

From the passage, the narrator further explained why he said the Ferris Wheel is complex. He revealed that the way the wheel works is complicated. So, the antonym is simple. Option D is correct answer.

He always says he____the highest marks but he doesn't (is getting_is going to get)​

Answers

Answer:

is going to get the highest marks but he doesn't

help with this please and don’t guess i’ll give brainlist

Answers

Answer:

if I am not wrong the answer is d

Explanation:

What is the purpose of US Not Greatest Country Ever by Michael Kinsley? The article is on Politico.

Answers

Answer:

The purpose of the government is to support the will of its citizens. The electorate of this great country has the right even couple.

who is the surprise joiner of the rumble?

btw this question is from the outsiders

Answers

Answer:

Paul Holden steps forward from the Soc side; he is one of Darry's ex-friends from high school, and now he looks at Darry with a mixture of contempt, pity, and hate. Ponyboy realizes that Darry is not only jealous of Paul and the opportunities he has that Darry doesn't, but he is ashamed to be representing the Greasers. The two young men start to circle each other in the silence, and Ponyboy thinks about how they shouldn't hate each other.

Explanation:

According to Lincoln's second inaugural address, what motivates people to struggle for change?

Answers

Answer:

People are motivated to struggle for change when they have had to deal with injustices and it gets to the point that it becomes unbearable. People fight for equality of opportunities, equal treatment under law, and for equal rights.

i need these definitions please
repetition:
figurative language:
rhetorical device:

Answers

Answer:

1 - something that repeats or is done two or more times.

2 - "Figurative language is language that's intended to create an image, association, or other effect in the mind of the listener or reader that goes beyond the literal meaning or expected use of the words involved."

3 - "A rhetorical device, persuasive device, or stylistic device is a technique that an author or speaker uses to convey to the listener or reader a meaning with the goal of persuading them towards considering a topic from a perspective, using language designed to encourage or provoke an emotional display of a given perspective or action"

Answer:

Ofc.

Repetition: The action of repeating something that has already been said or written.

Figurative Language: A language that's intended to create an image, association, or other effects in the mind of the listener or reader that goes beyond the literal meaning or expected use of the words involved.

Rhetorical device: Persuasive device or stylistic device is a technique that an author or speaker uses to convey to the listener or reader a meaning with the goal of persuading them towards considering a topic from a perspective, using language designed to encourage or provoke an emotional display

Explanation:


Sentence Fragments and Run-on Sentence Practice
Select the sentence from each group that sa sentence fragment or a run-on sentence.
A. Probably two to three hours, depending on how hard the task is.
B. The test seemed impossible, but I managed to make an A.
C. We went shopping this past weekend,
D. He wanted the blue one.

Answers

Answer:

C

Explanation:

A and D but maybe C

3. Key Ideas and Details: How does the author connect his statement that America

should tell other countries to behave mercifully with the list of American

corporations with branches in Singapore?

2018 College Board. All rights reserved.

Answers

Answer and Explanation:

The author shows how American companies have a strong influence on the economy of Singapore, as in other countries and that because of this influence, the American government can impose that not only Singapore, but that all countries have better attitudes, otherwise these companies can be withdrawn from these countries, which would cause certain economic problems.

In other words, the author states that the USA cannot impose American values in foreign territories, but it can cause these values to be met using the influence it has economically in those territories, through the list of American companies that the foreign country has.

What acts of kindness do Barbara and the other waitresses do for their customers? In nickel and dime?

Answers

Answer:

The penny penny Nicole dime

Explanation:

Identify four ways that nonverbal communication can be used when speaking in public.

Answers

Answer:

There are many ways but here's four: facial expressions, gestures, eye contact, and body posture

Answer:

nodding, high fives, jumping up and down, winking, smiling, frowning, fist bumping.

Explanation:

Comment below if you need me to answer your questions !! :D

Answers

Answer:

0f what question are you talking

Answer:

Help anwer my question https://brainly.com/question/19718319

Explanation:

Ayye its Drippqueen. i got the bars. We all know rappin is not really hard.

In class we had to write a rap and tell what the rhyme scheme is. I dont know what a rhyme scheme is. Can you define what a rhyme scheme is and tell me what the rhyme scheme of my rap is please?

Answers

Answer:

Swear to god not tryin to get free pts but i fr don't see nun

Explanation:

Answer:

okay a rhyme scheme is something like aabbcc

your rap is ababc, let me give u an example

apples are tasty

but im really lazy

i was talking to much

so she told me to start walking

that right there is aabb

Explanation:

Other Questions
|-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble. . Why is spell check not completely reliable as an editor? is francium found in nature or lab? what is a film interpretation The students are trying to raise 3.000 but they only have 1200 how much would they need to get to 3000 According to the graph below, at which point is the plant preforming the most photosynthesis? A. Point D. B. Point B. C. Point C. D. Point A. How did African American life compare to the typical white person's life in the 1950's?