Which shows the use of a fulcrum? Choose all that apply.



Choose all answers that are correct.
Question options:


Hands opening a bottle with bottle opener


Man moving rock with a lever


Boy using an ax to cut wood in forest



Answers

Answer 1

Answer:

Hands opening a bottle with bottle opener


Related Questions

Someone please tell me the answer with working please!! I

Answers

by investigating the graph, we can see that at x=20, y=8. therefore, the spring will stretch 8 cm.

What are the forces that resist motion that make Newton's 1st Law hard to completely visualize on Earth?

Answers

here’s a pic of old notes, hopefully it can help.

Professional research telescopes should be large enough to gather sufficient radiation from space. Which of these statements best explains why a reflecting telescope is best used as a professional research telescope?
Question 5 options:

Mirrors of reflecting telescopes gather harmful radiations from space.

Bigger lenses are easier to manufacture and they produce less distortion.

The series of mirrors and lenses help to reduce distortion of images.

Reflecting telescopes reflect away more radiation and distort images.

Answers

Answer:

Bigger lenses are easier to manufacture and they produce less distortion.

Explanation:

A reflecting telescope is best used as a professional research telescope because " Bigger lenses are easier to manufacture and they produce less distortion."

This is evident in the fact that the mirror of a reflecting telescope is simpler and inexpensive to be manufactured.

Also reflecting telescope is known not to support chromatic distortion, which often is a byproduct of dispersion.

Answer:

Bigger lenses are easier to manufacture and they produce less distortion

Explanation:

PLEASE HELP ME! IM TIMED

Answers

Answer: tectonic plates

Explanation:

The last one D:):) hope this helps

(8th grade HELP)
1. Inertia causes a stationary object to...
a.stay still
b.move
c.have an increased velocity
d.change it’s speed or direction
2. Once an applied force causes an object to start moving, the object keeps moving because....
a.none of the above
b.the force continues to be applied to it
c.no other force is acting on it
d.it has inertia

Answers

What is the question your asking

Electromagnetic radiation is emitted by accelerating charges. The rate at which energy is emitted from an accelerating charge that has charge q and acceleration a is given by dEdt=q2a26πϵ0c3 where c is the speed of light.Part AIf a proton with a kinetic energy of 5.0 MeV is traveling in a particle accelerator in a circular orbit with a radius of 0.530 m , what fraction of its energy does it radiate per second?(dE/dt)⋅1sE =

Answers

Answer:

 P /K = 1,997 10⁻³⁶  s⁻¹

Explanation:

For this exercise let's start by finding the radiation emitted from the accelerator

       [tex]\frac{dE}{dt}[/tex] = [tex]\frac{q^{2} a^{2} }{6\pi \epsilon_{o} c^{2} }[/tex]

the radius of the orbit is the radius of the accelerator a = r = 0.530 m

let's calculate

       \frac{dE}{dt} = [(1.6 10⁻¹⁹)² 0.530²] / [6π 8.85 10⁻¹² (3 108)³]

      P= \frac{dE}{dt}= 1.597 10⁻⁵⁴ W

Now let's reduce the kinetic energy to SI units

       K = 5.0 10⁶ eV (1.6 10⁻¹⁹ J / 1 eV) = 8.0 10⁻¹⁹ J

the fraction of energy emitted is

      P / K = 1.597 10⁻⁵⁴ / 8.0 10⁻¹⁹

      P /K = 1,997 10⁻³⁶  s⁻¹

Which TWO of the following examples are a chemical reaction?
A melting ice
B breaking glass
C crumpling paper
D rusting iron
E burning wood

Answers

Answer:

D and E

Explanation:

They both produce a new object or substance afterwards.

Answer:

D. and E.

Explanation:

Hope this helps and I hope u have an Amazing day!!

In its American colonies, Spain helped the Catholic Church meet its goal of
finding gold.
gaining territory.
converting people.
achieving glory.
This is from ed please help thank you

Answers

Answer: Converting people

Explanation: In Spanish colonies such as Florida, Spanish moved up into the other states to spread their christianity and were successful with doing so.

Converting people but I’m not sure

Leo places a plant in front of the center of curvature of a concave mirror. Which characteristics will the image of the plant have? Check all that apply.

Answers

Answer:

1, 3, 5,

Explanation:

A concave mirror is a hollowed sphere that has been cut into parts, each of which has a painted exterior. The plant's image has the qualities of a real, inverted, and smaller image. So, the correct options are A, C and E.

What is Concave mirror?

A hollow spherical formed into a mirror when the external surface of the each cut portion was painted, reflecting light from the interior surface. This kind of mirror is known as a concave mirror. When the concave mirror is placed too close to the item, a magnified and phoney image results.

This has an inward-curving reflective surface that faces away from the source of light. Light is reflected internally to a single focus point. Headlights on cars and torches are examples of concave mirrors. But, as the distance grows between the object and the mirror, the size of the image reduces and a real image is produced.

Thus, the correct options are A, C and E.

Learn more about Concave mirror, here:

https://brainly.com/question/25937699

#SPJ3

Your question is incomplete, most probably the complete question is :

Leo places a plant in front of the center of curvature of a concave mirror. Which characteristics will the image of the plant have? Check all that apply.

Real virtual inverted upright smaller larger same size.

A stone dropped from the top of a 80m high building strikes the ground at 40 m/s after falling for 4 seconds. The stone's potential energy with respect to the ground is equal to its kinetic energy

Answers

Answer:

A

Explanation:

Given that a stone dropped from the top of a 80m high building strikes the ground at 40 m/s after falling for 4 seconds. The stone's potential energy with respect to the ground is equal to its kinetic energy. (use 9 - 10 m/s)

O at the moment of impact

2 seconds after the stone is released after the stone has fallen 40 m

when the stone is moving at 20 m/s

At the top of the hill, the P.E = mgh

P.E = 10 × 80 × m

P.E = 800m

At the moment of impact, K.E = 1/2mv^2

K.E = 1/2 × 40^2 × m

K.E = 1/2 × 1600 × m

K.E = 800m

Since both P.E and K.E are the same, we can therefore conclude that the stone's potential energy with respect to the ground is equal to its kinetic energy at the moment of impact.

The correct answer is option A.

Question in the photo

Answers

Answer:

a lever that is what is used

C) lever that is what is used

Hi......





............

Answers

Answer:

Heyy!

Explanation:

..********************

Carbon is stored in leaves in various forms, such as sugar. When leaves decay, they lose mass. Which of the following sentences explains what happens to the carbon that is stored in leaves when they decay?
a. The carbon evaporates.
b. The carbon is destroyed as the leaves decompose.
c. The carbon is converted into nitrogen by bacteria in the soil.
d. The carbon is converted into carbon dioxide and released into the atmosphere.

Answers

Answer:either D or C

Explanation:

The carbon is converted into carbon dioxide and released into the atmosphere. therefore the correct answer is option D

What is a Chemical compound?

A chemical compound is a combination of two or more either similar or dissimilar chemical elements, for example, H₂O is a chemical compound made up of two oxygen atoms and a single hydrogen atom.

These chemical compounds are formed because of different types of bonds between the constituent's elements, the chemical bonds are mainly ionic bonds, covalent bonds,s, and hydrogen bonds.

Carbon is stored in leaves in various forms, such as sugar. When leaves decay, they lose mass.

The carbon is converted into carbon dioxide and released into the atmosphere is the sentence that explains what happens to the carbon that is stored in leaves when they decay.

Thus, the carbon is converted into carbon dioxide and released into the atmosphere. the correct answer is option D.

Learn more about a chemical compound from here

brainly.com/question/12166462

#SPJ6

A rock hits a window and stops in 0.15 s. The net force on the rock is 58 N during the collision. What is the magnitude of the change in momentum of the rock?​

Answers

Answer:

8.7kgm/s

Explanation:

Change in momentum=force×time

Which physical property is best measured using only a balance? A. Density B. Volume C. Color D. Mass​

Answers

Answer:

D. Mass

hope it helps

Explanation:

Mass is commonly measured with a balance

If a 50kg boulder is 100m off the ground and a 25 kg boulder is 100 m off the ground, which has a
stronger gravitational force pulling it towards Earth?

Answers

Answer:

Explanation:

It 100 kg It think

How do you compare the mass of proton, neutron, and
electron?

Answers

Answer:Explanation:

Protons and neutrons have very similar mass, while electrons are far lighter, approximately 11800 times the mass. Protons are positively charged, neutrons have no electric charge, electrons are negatively charged. The size of the charges is the same, the sign is opposite.

Name two ways to decrease the electric force between two charged objects.

Answers

Answer:

Inverse relationships are common in nature. In electrostatics, the electrical force between two charged objects is inversely related to the distance of separation between the two objects. Increasing the separation distance between objects decreases the force of attraction or repulsion between the objects.

Explanation:

Two ways to decrease the electric force between two charged objects:

by lessen charge of the test objects.by increasing distance between test change and source charge.What is coulomb force?

As a result of their electric charge, particles or objects are attracted to or repelled by the Coulomb force, also known as electrostatic force or Coulomb interaction. Charles-Augustin de Coulomb, a French scientist who published the findings of an experimental inquiry into the proper quantitative description of this force in 1785, gave the electric force its name. The electric force is one of the fundamental physical forces.

Positive or negative electric charges that are similar to one another repel one another in a straight line between their centers. Positive and negative charges that are opposite each other are drawn together along a straight line connecting their centers.

Learn more about coulomb force here:

https://brainly.com/question/11141051

#SPJ5

Question 12 of 20
How does decreasing the length of a wire affect a circuit?
A. It reduces the resistance caused by the wire.
B. It reduces the voltage carried by the wire.
O C. It increases the resistance caused by the wire.
D. It increases the current passing through the wire.

Answers

If we decrease the length of the wire in a circuit,  It reduces the resistance.

What is resistance?

Resistance is the opposition offered to the flow of current by a circuit element. The factors that affect resistance include;

Length of the wireCross sectional area of the wire

Hence, if we decrease the length of the wire in a circuit,  It reduces the resistance caused by the wire since the resistance depends on the length of the wire.

Learn more about resistance: https://brainly.com/question/15067823

Answer: A

Explanation:

Biker 1 is on a motorcycle facing West is initially at rest. The motorcycle speeds up from rest to 25 mph in three seconds.
Biker 2 is right by his side to start. He speeds up from rest to 85 mph in eight seconds.

Which biker has a greater acceleration?

Answers

Biker 1's acceleration:

(25 mph) / (3 s) = ((25 mi/h) • (1/3600 h/s)) / (3 s) ≈ 0.00231 mi/s²

Biker 2's acceleration:

(85 mph) / (8 s) = ((85 mi/h) • (1/3600 h/s)) / (8 s) ≈ 0.00295 mi/s²

Biker 2 has the greater acceleration.

Question 4 of 10 Which three components define a person's overall health? A. Mental and emotional health B. Social health C. Physical health D. Public health​

Answers

Answer:

physical, social, and mental

Explanation:

Answer:

A,B,C

Explanation:

These three maintain the overall health of the person being. Take for instance an example a cake, it has layers that make the overall cake. So it is with the persons health, it takes all three of these feilds to make the overall health.

Example of kinetic energey

Answers

Answer:

rolling ball down a hill

Explanation:

A rolling ball has kinetic energy

Answer: An airplane has a large amount of kinetic energy in flight becuase of its large mass and fast velocity.

Explanation:

a 5 kg object is pushed with a 10 n force for 1 second how much will the momentum of the object change?

Answers

Answer:

5 kg m/s

Explanation:

Because you need 5 N to push a 5 kg object so 5 will be left over

PLS HELP which ones would be made of cells? and which ones show cell walls?

Cork, Sponge, Wood, Plastic, Tree

Answers

The first question's answer depends on what you mean by "sponge". If you're talking about sea sponges, then all but plastic are made up of cells. Some sponges used for cleaning are also made of plant material but also other, non-organic materials like dyes.

Cell walls are only present in plant cells, so they would be found in cork (derived from a certain tree bark), wood, and trees. Synthetic sponges made with plant material might also contain them, but they wouldn't be made entirely of cells with walls.

From given options or choices all are made up of cells except plastic and among the other four Cork, Sponge, Wood, and tree all show cell walls except Sponge.

A cell is the basic structural unit of all living organisms and contains various cell organelles. On the base of different cell organelles or presence or absence of the certain organelles help in distinct and divide the cell type.

The major types of cells are:

Prokaryotic cellsEukaryotic cells

Plastic is not a living organism as there are no cells and is made up of polymers of hydrocarbon.

The cell wall is one of the major cellular structures that helps in identifying the type of cell organism and protects the organism from the external environment. It classifies the organism on its constituent of the cell wall.

In eukaryotic cells, animal cells have no cell wall, however, fungi cells, plant cells have a cell wall. A sponge is an animal and other cork wood, and trees are plants or plant-based products.

Thus, the sponge does not show the cell wall.

Learn more about the cell wall:

https://brainly.com/question/18662393

PLEASE HELP ME! IM TIMED

Answers

Answer:

the third one

Explanation:

the 1991 eruption of mt. pinatubo was the scariest in history

Answer:

C

Explanation:

It is based on someone’s experience and how they felt about the accident

Karla Ayala pulls a sled on an icy road (dangerous!). Because of Karla's pull, the tension force is 151 N, and the rope makes a 20.0° with the horizontal. If the 7.0-kg sled is pulled across 10.0 meters, what is the work done by Karla?

Answers

Answer:

W = 1418.9 J = 1.418 KJ

Explanation:

In order to find the work done by the pull force applied by Karla, we need to can use the formula of work done. This formula tells us that work done on a body is the product of the distance covered by the object with the component of force applied in the direction of that displacement:

W = F.d

W = Fd Cosθ

where,

W = Work Done = ?

F = Force = 151 N

d = distance covered = 10 m

θ = Angle with horizontal = 20°

Therefore,

W = (151 N)(10 m) Cos 20°

W = 1418.9 J = 1.418 KJ

A rock has a mass of 3.1 kg. What is its weight on earth

Answers

Answer:

W = 30.38 N

Explanation:

Given that,

Mass of a rock, m = 3.1 kg

We need to find the weight of the rock on the surface of Earth. Weight of an object is given by :

W = mg

g is the acceleration due to gravity, g = 9.8 m/s²

W = 3.1 kg × 9.8 m/s²

= 30.38 N

So, the weight of the rock on the Earth is 30.38 N.

PLEASE HELP
is lighting firecrackers a form of conduction, convention, or radiation

Answers

Answer:

Convection

Explanation:

conduction is like, electricity. radiation is like using a microwave.

Answer:

conduction

Explanation:

recall that conduction is the transfer of heat between objects that come in direcr contact.

You are putting heat directly on the part of the firework that allows it to spark, therefore it is conduction.

Convection takes place within a fluid.

Radiation is indirect heat through waves. (think of the sun warming us indirectly)

Which of the following is an example of adhesion?

Answers

what are the answers?

Integrated science please help ASAP!...

Answers

1: sewage
2: agriculture pollution
3: oil pollution
4: radioactive substances
5: river dumping
6: marine dumping
This is all I can find I hope this helps.

Answer:

SewageAgricultural pollutionOilRadioactive substanceRiver dumpingMarine dumpingLittering trash Industrial wasteMining activitiesChemical fertilizers

Explanation:

I hope this helps

Other Questions
25. Which of these does natural selection work on?a. Only animalsb. All populationsc. Only microscopic organismd. Individualse. Only small The graph of a system of equations will intersect at exactly 1 point? PLZ HELP! DUE TODAY! I WILL GIVE BRAINLIEST TO FIRST ANSWER THAT IS CORRECT!The parts of a personal letter are similar to a business letter but slightly different in form. True False Angle J and angle K are complementary angles. The measure of angle J is 18 less than the measure of angle K. Fine the measure of both angles.Please and thank you. Describe the pattern in the following sequence and list the next three terms:4,8, 16, 32, ... I need help with this ASAP ..... It is over due and I have to get it done and show work .. Please and thank you who is your favorite character from Gorillaz and why?? :) what are Sources of thermal pollution Solo Corp. is evaluating a project with the following cash flows: Year Cash Flow 0 $28100 1 10,300 2 13,000 3 14,900 4 12,000 5 8,500 The company uses an Interest rate of 8 percent on all of Its projects. a. Calculate the MIRR of the project using the discounting approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places. e.g., 32.16.) b. Calculate the MIRR of the project using the reinvestment approach. (Do not round Intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) c. Calculate the MIRR of the project using the combination approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) a. Discounting approach MIRR % b. Reinvestment approach MIRR % c. Combination approach MIRR Y. Find the quotient: 6)27L 600 mL Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT The corect phase sequence shownGas, Liguid, SolidLqud, Gas, SolidSold, Liguid, GasGas, Solid, Liquidabove i Which word comes from the Greek root meaning life A-boulevard B-BiologyC-bombardD-barometer Can Someone help me please Requiring children to be vaccinated before entering school is an example of what power? need help for civics What is the mass of 1.00 mol of oxygen (O2)? Cual Es el mejor programa esta ano A car is 180 inches long. A truck is 75% longer than the car. How long is the truck? How are ionic compounds named? Giving everything. Plzzz help.