Please help me I don’t understand

Please Help Me I Dont Understand

Answers

Answer 1

Answer:

the first and fifth one

Step-by-step explanation:

Answer 2

Answer:

the first and second one

Step-by-step explanation:


Related Questions

si en una caja hay 5 pelotas una verde una amarilla.una azul.una negra y una roja ya a salido la rija y la verde cual es la posibilidad de sacar la azul en una cuarta vez​

Answers

Answer:

uno a tres

Step-by-step explanation:

Creo que es correcto

Avísame si estoy equivocado

Y que tengas un feliz día de acción de gracias

The sum of two numbers is 29 The difference is 9 Find the numbers

Answers

Answer:

19 and 10

Step-by-step explanation:

please mark brainliest :))

-4x 3 y 2(7xy 4) i need help

Answers

Answer:

−672x2y2

Step-by-step explanation:

The answer is:

-28x^4y^6

mark runs 5 miles in 40 minutes. if he continues at the same rate can he run 14 miles in 120 minutes

Answers

Answer: Supposedly if he continued at the same rate he could run up to 15 miles in 120 minutes. If that’s the case then, yes, he can run 14 miles in 120 minutes.

What is the opposite of each number?

Drag the answer into the box to match each number.

Answers

Answer: If it has a negative sign then drag it to one that doesn't have one and vice-versa

Step-by-step explanation:

so 0.005 would be -0.005

Answer:

the opposite of 0.005 is -0.005

the opposite of 1/2 is -1/2

the opposite of 0 is 0

the opposite of -2 is 2

Step-by-step explanation:

Jim was thinking of a number. Jim doubles it and adds 8.8 to get an answer of 81.7. Form an equation with x from the information.

Answers

Answer:

x = 36.45

Step-by-step explanation:

set up equation

2x + 8.8 = 81.7

subtract 8.8 from both sides

2x = 72.9

divide 2 from both sides

x = 36.45

Can someone please help me???

Answers

Answer: Y=2x+1

Step-by-step explanation:Idk the second answer but I know the first one

Manuel se ha gastado 2/8 partes de la paga en ropa y 1/12 parte en dulces. ¿Qué fracción de la paga le queda?, ¿Si le dieron 45€ de paga, cuanto ha gastado y cuanto le queda?.

Answers

Responder:

2/3; 30 €

Explicación paso a paso:

Fracción gastada en ropa = 2/8

Fracción gastada en dulces = 1/12

Fracción restante:

1 - (Fracción gastada en ropa + fracción gastada en dulces)

1 - (2/8 + 1/12)

L. C. M de 8 y 12 = 24

1 - (6 + 2) / 24

1 - 8/24

1 - 1/3

= (3 - 1) / 3

= 2/3

Si la paga era de 45;

Cantidad restante: 2/3 de 45

= 90/3

= 30 €

Rotate this figure 90 degrees counterclockwise.
pls answer quick 20 points :D

Answers

Answer: It's number 4.

Fill out the following data table using the equation y=3x-5

Answers

You should put this into a graphing calculator! They have an option to put the equation in and it shows you the table that goes with it!

Use always, sometimes or never to make a true statement:


Intersecting lines are _____________ coplanar.


Two planes _____________ intersect in exactly one point.


Three points are _____________ coplanar.


A plane containing two points of a line _____________ contains the entire line.


Four points are _____________ coplanar.


Two lines _____________ meet in more than one point.


Two skew lines are __________ coplanar.


Line TQ and Line QT and are _________ the same line.

Answers

Answer:

1. Intersecting lines are always coplanar

2. Two planes never intersect in exactly one point

3. Three points are always coplanar

4. A plane containing two points of a line always contains the entire line

5. Four points are sometimes coplanar

6. Two lines never meet in more than one point.

7. Two skew lines are never coplanar

8. Line TQ and Line QT are always the same line.

Step-by-step explanation:

Note: Coplanar means "In the same plane"

1. Each line exist in many planes. But different lines must share at least one plane for them to intersect. That is why intersecting lines are always coplanar.

2. Two planes never intersect at exactly one point because only lines intersect at a point. Planes can only intersect along a line.

3.Three points are always coplanar because in geometry, a group of points are coplanar because there is a geometric plane that they all lie on.

4. A plane containing two points of a line always contains the entire line. Yes

5. Four points are only sometimes coplanar because there is a probability that they may all not lie on the same plane

6. Two lines never meet in more than one point because lines are basically straight and cannot bend over to intersect at another point

7. Two skew lines are never coplanar because skews lines are lines that do not intersect and are never parallel.

8. Line TQ and Line QT are always the same line because a line is straight and extends from one point to the other. So, if a line is labelled TQ calling it QT means the same thing

Think About the Process The length of a rectangle is twice the width. The area of the rectangle

is 86 square units. Notice that you can divide the rectangle into two squares with equal area. How

can you estimate the side length of each square? Estimate the length and width of the rectangle.

How can you estimate the side length of each square?

OA. Estimate V86.

OB. Estimate V43 .

V 86

OC. Estimate

4.

43

OD. Estimate

4

The rectangle is units long and units wide.

.

(Round to the nearest tenth as needed.)

Answers

Answer:

length of each square= [tex]\sqrt{43}[/tex] ≈ 6.6

the length of the rectangle = 2[tex]\sqrt{43}[/tex] ≈ 13.1

width of the rectangle ≈ [tex]\sqrt{43}[/tex] ≈ 6.6

Step-by-step explanation:

How many 1-yard-square tiles would it take to cover this rectangle? Dimensions are in yards.

Answers

Answer:

it would take 520^2 tiles

Step-by-step explanation:

LxW

26×20

520 yrds^2

An elementary school has 1,134 seeds. The seeds will be planted in 27 rows.
Each row will have the same number of seeds. How many seeds will be planted
in each row?

Answers

42 plants will be planted in each row
You divide 1,134 by 27 and get 42 as your answer

Answer:

42 seeds

Step-by-step explanation:

You would first divide 1,134 seeds by 27 rows. You would get 42 seeds per row, and that would be your answer.

Which choice shows the correct solution to 2528 ÷ 8?

Answers

I believe The answer is B


Answer:

B.

Step-by-step explanation:

Hope it helps!

What is the range of the function on the graph?
LO
4
all the real numbers
O all the real numbers greater than or equal to 0
O all the real numbers greater than or equal to 2
O all the real numbers greater than or equal to -3
21
2 1
2 3 4 5 x
-5 -4 -3 -2 -11
-2
-3
-4
-5

Answers

the answer is all real numbers

The range of the function on the graph are all the real number greater than or equal to -3.

What is Function?

A function is a relation from a set A to a set B where the elements in set A only maps to one and only one image in set B. No elements in set A has more than one image in set B.

Given the graph of a function.

A function f(x) has the domain equal to the all values of x that the function is defined for.

Range of the function is the set of all the values of the function for the x in the domain.

Here, the function values are from infinity to -3 and then again mover from -3 to infinity.

So the range consists of all the real numbers from -3.

Hence the range of the function is the set of all real numbers from -3.

Learn more about Range here :

https://brainly.com/question/21027387

#SPJ7

Which point on the y-axis lies on the line that passes
through point G and is parallel to line DF?

O (-2, 0)
0 (0,-2)
0 (0,4)
O (4,0)


Answers

I think it’s the (0,4)

Answer:

Step-by-step explanation:

y = mx + b , "m" is a slope and "b" is y-intercept (0, b)

~~~~~~~~~~

G(- 4, - 4)

Slope [tex]m_{DF}[/tex] = 2

y + 4 = 2(x + 4)

y = 2x + 4 ⇒ (0, 4)

PIC BELOW
Need answer ASAP

Answers

Option D. 17/10 or 1.7 is correct or 1 7/10 is also correct :)

Answer:

I'm sure the answer is 1 7/10

Step-by-step explanation:

I fixed my computer. Here's the reason:

7/2 - 9/5 = 17/10 = 1 7/10

Sorry about the last question hope this one helps! :3

Which points (0,6) (7,9) (2,3) go through the line 3x+2y=12

Answers

Answer
(0,6)
Explanation

1) The value of y varies directly with x. If x = 3, then y = 13.
Show your work for finding the value of x when y = 39?

Answers

Answer:

When y is 39 x is 3.

Step-by-step explanation:

Proportions!

x = 3

y = 13

We need to find our multiplier first. How did 13 turn into 39?

39/13 = 3

13 * 3 = 39

We multiplied by 3!

Now we multiply x by three to keep the propotion, proportional!

x= 3

(3) * 3 = 9

Now we make the proportion

3 : 39

When y is 39 x is 3.

Consider Brainliest! Hope this helped!


Find the slope of the line that passes through (-44, 7) and (-4, 99).

Answers

Answer: 2.3

Equation of the line:
y=2.3x+108.2

el número de llegadas al servicio de urgencias de un hospital es de 2 cada 15 min. Si se supone que
el numero de llegadas se distribuye en un modelo de Poisson, se pretende calcular la probabilidad
de que en los próximos 15 min se produzcan 4 llegadas.
Ayuda por favor, es urgente. ​

Answers

Answer:

Uh I don’t speak u language

Step-by-step explanation: Sorry :/

3X +17+ 5X equals 7X +10

Answers

the answer is x=-7
you minus 7x to the left side and minus 17 to the right side then you get x= 10-17 which is x=-7

Answer:

I think the answer is x= -7.

Sally sim Tim and joah each have 14 baseball cards sam has 20 Pokemon cards how many baseball cards do they have in all

Answers

Answer: 14

Step-by-step explanation: Pokémon cards are different than baseball cards and are two different things.

What are the solutions of this graph? *

Answers

I think it’s the last one!

Can someone give me the reason why 2 is congruent to 11

Answers

Answer:

alternate int. <s of parallel lines

Step-by-step explanation:

We are told that lines r and s are parallel.

Lines r and s are curt by transversal line m.

Theorem:

If two parallel lines are cut by a transversal, then alternate interior angles are congruent.

Angles 2 and 11 are alternate interior angle, so they are congruent.

Answer: alternate int. <s of parallel lines

2 is congruent to 11. A way to justify this is because 2 is congruent to 3 because they are vertical angles. 3 is congruent to 11 because they are corresponding angles. Thus 2 is congruent to 11 through the transitive property.

a hemisphere has a volume of 381.7 inches .what is the radius of the hemisphere

Answers

Answer:cube root 381.7

Then half it too find the radius.

Step-by-step explanation:

Reupload please help this is due in 2 hours DONT ANSWER IF U DONT KNOW:)

Answers

total profit = total amount earned - cost of ingredients
P = 5s - 1160

i need somebody help on this test i am Taking

Answers

Answer:

ok and thank you for point

Find the area of a square with side length x when x is equal to the given value.
Are the area of a square and the length of its side directly proportional? Justify
your answer.
x = 10 in.

Answers

Answer:100

Step-by-step explanation:

Answer:

100

Step-by-step explanation:

Because you multiply 10 * 10.  Which equals 100.  And they are not directly proportional quantities.

Other Questions
What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns what is the range and domain of this question? im unsure A 45 kg object has a momentum of 225 kg-m/s northward. What is the object's velocity?A. 180 m/sB. 5.0 m/sC. 10,125 m/sD. 0.20 m/s Mrs. Chin paid a 20 percent tip on the bill for lunch.PercentsTotal20%20%20%20%20%100%$2.75$2.75$2.75$2.75$2.75If the tip amount was $2.75, what was the bill for lunch before the tip was added to it?$5.50$13.75$16.50$55.00 4n-(7-6n)Helppp plz Leia just read that the national debt owed by the federal government is at an all-time high. (Explain any possible impact on the federal government from unexpected inflation.) What is the mass of HF produced by three reaction of 3.0 10 to the 23 molecules of H2 with excess F2 Please help this one is also due tomorrow Lydia buys 5 pounds of apples and 3 pounds of bananas for a total of $8.50. Ari buys 3 pounds of apples and 2 pounds of bananas for a total of $5.25. Determine a system of equations that represents the given the situation. Let x be cost per pound of apples and let y be the cost per pound of bananas. Which equation represents the amount of money Lydia spent of apples and bananas? Which equation represents the amount of money Ari spent on apples and bananas? Choose the word or phrase that best completes each sentence. prepared the body for its journey to the afterlife.The were constructed as tombs for the pharaohs and their relatives.Tutankhamen's tomb was an important archaeological find because it was the only ever found. Ratios. May someone help me, also may you please add the explanation.