Thomas ran 1000 meters. How many kilometers did he run?

Answers

Answer 1

Answer:

one kilometer

Explanation:

Answer 2
5000 metres because 1km is 1000 metres

Related Questions

Give another word that is pronounced the same as the following
1)Lesson
2)Mall
3)Suite
4)Blue
5)Each

Answers

Answer:

1) besson

2) ball

3) neat?

4) clue

5) peach

Explanation:

Answer:

lessen

maul

suit

blew

Eetch (dish name)

4. An advance in science is a move a. backwards b. forwards c. laterally PLEASE HELP ​

Answers

It’s B - forward

Advance in science is progress, so forward is the answer.

What is the different between sal's two sets of grandparents in walk two moons book?

Answers

Answer:

The Hiddles were good but kind of strange. The Pickfords were very serious and stern.

Explanation:

https://quizlet.com/19650589/walk-two-moons-ch-1-5-flash-cards/#:~:text=What%20is%20the%20difference%20between,were%20very%20serious%20and%20stern.

Pickfords:

respectable

stern

Hiddles

weird

funny

silly

strange

2. Lakshmi begins the book as a 13 year old girl from Nepal. By the end of the book, her life in the brothel in India has completely changed from her life in the Himalayas of Nepal. It could be argued that Lakshmi’s naivete has given way to someone who understands the world in a whole new way. Find at least one example from the book illustrating this change and write a paragraph discussing your thoughts. Use at least one quote from the book to support your position.

Answers

Yo hey what’s up fam did you know that Alaska was bought in the Louisiana purchase for 2 cents an acre. That’s a pretty penny!

Free brainlest if you help me know what this poem means!! The reason why i want to give brainlest because I want to thank the kind people for helping me when i needed it the most :)
Carefree raindrops drop
Racing on my window panes
Drip drop! they fall down.

Answers

Answer:

umm okay....I have learnt this once but now forgot.....lemme remember

Explanation:

u know like when when rain falls there will be water droplets on the window right...these raindrops race each other meaning one of the raindrop reaches bottom before some of the other raindrops...it's like a race in which who will reach first...and eventually when the reach the raindrops reach bottom "Drip drop" the rainfall will fall from window to ground

wow my explanation is so bland

In my opinion. Carefree raindrops drop- represent moments of carefreeness in our live. Moments of peace or happiness. Moments of sadness or sorrow. Racing on my window panes- represent a period in our life maybe, a day, a week? Window usually represents our world. Our view. Something that you can see by looking in or out. Drip drop! They fall down- represents time. As fast as-drip drop- those days of peace, happiness, sadness, sorrow are gone. Life is unpredictable. Your mood is affected by the way you look at situation you find yourself in. Good luck.

r_ _gn



complete the following words​

Answers

Pretty sure it should be “Reign”

Answer:

reign

Explanation:

How does the author's use of "whispered," "winked," and "nudged" in
paragraph 2 impact the meaning of the paragraph? (RL.8.4)
O by making Oliver's request for more food seem humorous
O by emphasizing the danger to Oliver in requesting more food
O by highlighting their anticipation of Oliver's request for more food
O by contrasting the lighthearted attitude of the boys with Oliver's attitude

Answers

This question is missing the excerpt from "Oliver Twist". I have found it online. It is the following:

The evening arrived; the boys took their places. The master, in his cook's uniform, stationed himself at the copper; his pauper assistants ranged themselves behind him; the gruel was served out; and a long grace was said over the short commons. The gruel disappeared; the boys whispered to each other, and winked at Oliver; while his next neighbors nudged him. Child as he was, he was desperate with hunger, and reckless with misery. He rose from the table; and advancing to the master, basin and spoon in hand, said, somewhat alarmed at his own temerity: . . .

Answer:

The author's use of "whispered," "winked," and "nudged" in  paragraph 2 impact the meaning of the paragraph:

D. by contrasting the lighthearted attitude of the boys with Oliver's attitude.

Explanation:

From the excerpt, we can tell everyone knows that if any boy dares to ask for more food, the master gets furious and punishes him. However, Oliver is starving. The other boys are encouraging him to go and try to get more food, but they probably do not think he will actually do it. They are acting in a playful, lighthearted manner. Oliver, on the other hand, is not. He has serious reasons to be asking for food. Unlike the boys', Oliver's attitude is desperate. Having that in mind, we can choose letter D as the best option:

D. by contrasting the lighthearted attitude of the boys with Oliver's attitude.


1.Paragraphs always state a main idea with supporting details.

O A True

O B. False

2.Arabic numbers are used in outlines.

O A. True

O B. False

3.you should never put the date on your notes.

O A. True

O B. False

4.Notetaking is done only when you read something.

O A. True

O B. False

5.The subheadings are the supporting ideas in an outline.

O A. True

O B. False

6. Under no circumstances should you use abbreviations when taking notes.

O A. True

O B. False

7. The abbreviation for the Central intelligence agency is CIA.

O A. True

O B. False

8. Comparing and contrasting is one way to graphically represent your notes.

O A. True

O B. False

9. Permanship ship does not matter when you are taking notes.

O A. True

O B. False

10. Margins are often used to__________

O A. Color in.

O B. Add bits of information.

O C.Doodle.

O D take notes.


Answers

1) A
2) B
3) B
4) B
5) A
6) B
7) A
8) A
9) A
10) B

Identify a detail about the crisis that Wiesel faced when he was a boy. Explain how the memory shaped him as a person and motivated the work he did in the years. 3-4 sentences

Answers

Answer:

Elie Wiesel never forgot his luck to be alive which made him use his memories of that trauma to persevere and work through any other conflict he might have.

Read the excerpt from The Dark Game.
Tension between the two sides escalated until June 1948, when the Soviets blocked all western access to the capital. In this first real crisis of the Cold War, the West was not going to be denied by the Soviets. Since such tension was typical in the divided city, it should come as no surprise that Berlin in the early 1950s was a city of intrigue, espionage, and danger.
Which term means "spying"?

tension
escalated
divided
espionage​

Answers

Answer:

It is D

Explanation:

mark brainliest or give me 5 stars and 1 heart

Answer:d

Explanation:

D

Each of the featured performers in this video, "Immigrants" by Lin Manuel Miranda off his Hamilton Mixtape consider their identity to be linked to their immigration or their parents immigration to the US. How would you describe how these artists feel about their identity as immigrants?

Answers

Answer:

I would describe these artists to feel proud of their identity as immigrants. To tell the story of America as immigrants can make them feel valued for their own contribution to the building of the country.

answer any thing plzzzzzz​

Answers

Answer:

I am Confused can you make it bigger

Explanation:

Thaks

Answer:

i dont know search it up

Explanation:

A watering can contain 980 milliliters of water. Some water is used to water the plants. In the end, 350 milliliters of water are left. How much water is used to water the plants? So what fraction do I use

Answers

Answer:

630 milliliters

Explanation:

Total water in the watering can = 980 milliliters

Water used to water the plants = x millimeters

Water left in the can = 350 milliliters

Total water in the watering can = Water used to water the plants + Water left in the can

980 = x + 350

980 - 350 = x

x = 630 milliliters

Water used to water the plants = 630 milliliters

Fraction used = Water used to water the plants / Total water in the watering can

= 630 milliliters / 980 milliliters

= 63/98

= 9/14

People make energy using wind. Change the sentence into passive voice​

Answers

Energy is made by people using wind
Hope it helps you

Answer:

Wind is used by people to make energy.

Explanation:

In a passive sentence, the subject of the sentence is placed after the verb in the object position.

expository narrative argumentative

1) A cooking recipe​

Answers

Answer:

Cinnamon Rolls

Explanation:

Make the dough: The ingredients are pretty standard: flour, sugar, salt, yeast, water, milk, butter, and 1 egg. Heat the butter, milk, and water together. Next, stir the butter mixture into the dry ingredients, then add the egg. At this point, your dough is ready to knead!

Knead the dough: You can use your mixer or hands to knead the dough. Want to learn more about the process of kneading? I study this helpful guide often. When you’re finished kneading, cover the dough and let it rest for a few minutes so the gluten settles. During this time, get your filling ingredients ready: butter, cinnamon, and sugar.

Shape the cinnamon rolls: Roll the dough out into a 14×8 inch rectangle. Spread the butter on top, then sprinkle with cinnamon and sugar. You can use regular white granulated sugar or brown sugar in the filling. Tightly roll up the dough and cut into 11-12 pieces. Place in a greased round pan and get ready to rise.

Rise: Let the shaped rolls rise for 60-90 minutes. Remember, this is the only rise time for the rolls.

Bake: After the cinnamon rolls are nice and puffy, bake until golden brown.


Complete the sentence with the passive form of the verb to see.
Toby_______ kicking around a ball in the field.

Answers

Answer:

was

Explanation:

Toby was kicking around a ball in the field. Was is a passive form of verb.

What are verbs?

Verbs are defined as the verbs used in a phrase to express activity and indicate what the subject is doing. An inactive verb form is one that is called verbal. A verb can be a noun, an adjective, or an adverb. In English, the verb is the most "essential" aspect of speech.

The passive verb is defined as when the verb in a sentence does the work for the subject rather than the other way around. Pullum lists seven different varieties of passive voice. They are passive when used with the verb be, prepositionally, bare, embedded, adjectivally, get, and concealed. In passive sentences, the object receiving the action is the sentence's subject, while the object performing the action may be included toward the conclusion.

Thus, Toby was kicking around a ball in the field. Was is a passive form of verb.

To learn more about verbs, refer to the link below:

https://brainly.com/question/14574299

#SPJ2

Can someone tell me the link for the sally face image? xd

Answers

Answer:

What?

Explanation:

Answer:

Right-click and reverse image search.

Explanation:

Right-click and reverse image search.

what are some of the limitations of using first person perspective​

Answers

Most first person perspective tend to be biased, and narrows the experience.

WILL GIVE BRAINLIEST !!!!!! MARK FIVE STARS !!!!!! AND THANK !!!!!!

Write an informative essay explaining the different kinds of sacrifices people make, the value in making sacrifices, and how to determine when to make a sacrifice.

QUESTIONS: What is the topic of the essay? (A. criticizing types of sacrifice, B. debating when to sacrifice, C. exploring ideas about sacrifice)
What is the purpose of the essay? (A. to entertain by telling a story about sacrifice, B. to inform the reader about sacrifice, C. to argue that people should make more sacrifices.)

Answers

Answer:

1.C

2.B

Explanation:

Edge 2021

Informative essays hold readers' attention by providing them with relevant, fresh, and frequently unexpected facts and information.

What is Informative essay?

Readers anticipate learning something new from informative essays because they are instructional in nature. In truth, a lot of what is read and written in school and at work is educational.

Writing that is informative conveys crucial and helpful information about a subject and can be found in textbooks, reports, and tutorials like this one.

Informative essays offer helpful details like facts, examples, and research-based evidence to help readers better understand or perceive a topic. Although informational writing does not attempt to affect readers' ideas or behaviors emotionally, it should nevertheless be interesting to read.

Therefore, Informative essays hold readers' attention by providing them with relevant, fresh, and frequently unexpected facts and information.

To learn more about Informative essays, refer to the link:

https://brainly.com/question/29759737

#SPJ7

I need a(Thesis statement) for life in the city vs life in the countryside
Please help!!

Answers

Answer:

City Living vs. Country Living

There are many advantages and disadvantages of choosing to live in the country or to live in the city. But the advantages of living in the country definitely outweigh the advantages of living in the city.

In the city, public schools are often packed full of students resulting in larger class sizes and no real teacher student relationship.   You would be lucky if your teacher could put a name to your face.   Though, bigger schools in the city offer more courses for the student to take and also offer more extracurricular activities.   Where in the country, public schools often do not have many students making class sizes significantly smaller resulting in a better teacher student relationship.   Your teacher usually knows you by first and last name, and chances are, your teacher had a few of your family members as students.   Though these things are advantages, school in rural areas generally do not offer as many courses and also do not have as many extracurricular...

Explanation:

What is the conflict in storm runners by Roland Smith?

Answers

Chase gets separated from his dad

How to solve homelessness

Answers

By finding a job! Hope it helps

3. "That will ask some tears in the true performance of it... I will move storms; I will ____
in some measure."

Out of the words changeling, livery, darkling, remenice, troth, collied, brakes, buskined, leviathan, and condole, which one is the right word to fill in the blank?

Answers

“That will ask some years in the true performance of it...I will move storms; I will reminisce!

Read the following passage from Mary Shelley's Frankenstein.
After days and nights of incredible labor and fatigue, I
succeeded in discovering the cause of generation and life;
nay, more, I became myself capable of bestowing
animation upon lifeless matter.
The astonishment which I had at first experienced on this
discovery soon gave place to delight and rapture.
Which common notion from the historical context surrounding Frankenstein
does this excerpt most clearly show?
O A. Enlightenment thinking promoted learning and advanced
education for the betterment of human life.
B. The Romantics de-emphasized the influence of reason, and
instead emphasized human emotion.
C. Scientists were willing to interfere with the natural order that was
ordained by God, becoming god-like in their explorations.
D. Some doctors were unscrupulous, selling false medicinal
remedies and experimenting at the risk of their patients.

Answers

Answer:

A

Explanation:

So the reason that A is the answer is because all of the other options do not really show how the scientist realized his true cause, what he was meant to do. However, in option A, it shows that Frankenstein actually realized because of the Enlightenment what he was meant to do all along.

The common notion from the historical context surrounding Frankenstein that this excerpt most clearly shows is "Scientists were willing to interfere with the natural order that was ordained by God, becoming god-like in their explorations." The correct option is C.

Who is Victor Frankenstein?

In Mary Shelley's Frankenstein, the main character, Victor Frankenstein, is a scientist who becomes obsessed with creating life. In the excerpt provided, he describes how he has succeeded in discovering the secret of life and has become capable of animating lifeless matter. This idea of scientists interfering with the natural order and attempting to create life is a clear example of the theme of "playing God" that runs throughout the novel.

Option A, "Enlightenment thinking promoted learning and advanced education for the betterment of human life," is not the most appropriate option because while Frankenstein was written during the Enlightenment period, the excerpt does not specifically refer to the promotion of learning or advanced education.

Option B, "The Romantics de-emphasized the influence of reason, and instead emphasized human emotion," is also not the most appropriate option because while the novel is often considered a work of Romantic literature, the excerpt does not specifically emphasize emotion over reason.

Option D, "Some doctors were unscrupulous, selling false medicinal remedies and experimenting at the risk of their patients," is not the most appropriate option because the excerpt does not specifically refer to doctors selling false remedies or experimenting on patients. Instead, it focuses on the theme of scientific exploration and the idea of creating life, which was a common concern during the time the novel was written.

Therefore, The correct answer is option C.

To learn more about  The Gothic novel Frankenstein click:

https://brainly.com/question/9967497

#SPJ5

Part A: Which statement best summarizes the theme of the passage?​

Answers

Answer : I'll answer fastly as i can when you give me the Passage.

Explaination: None

Im really sorry

It is writing that connects ideas, concepts or events. It connects events, showing their patterns, relating them to each other or to specific ideas, themes or concepts. *

Answers

Answer:

The phrases shown above are showing the concept of narrative.

Explanation:

In general, we can call the narrative a story and as it was presented in the question above, the narrative is a set of events that establish a relationship between themselves, connect ideas and concepts, creating a cohesive and fluid text. Despite being a topic related to writing, a narrative can also be established through spoken words, as long as the words connect ideas and present events capable of telling a well-organized and coherent story.

Read the following passage from “The Camera Does Lie” and answer the question.

1.)The best way to start your analysis is to ask questions like, “could an eagle lift and carry a child that size?” 2.) The larger the bird is, the larger its wingspan must be to get it off the ground and keep it airborne. 3.) Estimating the size of the child in the video at about 28 pounds means the eagle is lifting almost twice its own weight. 4.)This would take a wingspan of about 33 feet.

Which of the sentences is most likely the topic sentence?

the second one
the first one
the third one
the fourth one

Answers

Answer:

the second one

Explanation:

The topic sentence is the most important sentence found at the introductory part of a text. It highlights and summarizes the main point of the text. Sometimes, it is the first sentence in the paragraph but this is not always the case.

In the sentence above, the topic sentence is the second one because it states an important point about birds which might be the basis of the text. More details to support this important detail about birds will be found in the succeeding sentences and paragraphs.

2.) Over the hill.
a.) Sentence
b.) Fragment

Answers

Fragment.

(Examples of a sentence below)

Who is going over the hill?Why are we going over the hill?When are we going over a hill?What hill are we going over?

Hope this helps?

~NatLikesAnime~

#LearningWithBrainly

In your own words, please define “theme”.

Answers

Answer:

Some common themes in literature are "love," "war," "revenge," "betrayal," "patriotism," "grace," "isolation," "motherhood," "forgiveness," "wartime loss," "treachery," "rich versus poor," "appearance versus reality," and "help from other-worldly powers."

Explanation:

Which of these is the ability to critically evaluate the messages that come
through media texts?
A. Narrative
B. Connotation
C. Deconstruction
D. Media literacy

Answers

Answer:

D

Explanation:

Media Literacy

Answer:

D. Media literacy

Explanation:

Other Questions
PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible. Consider the linear equation. 5x+6y=15 Which point represents a solution to the equation? Is there a closed economy? A, B, C and D are points on the circumference of a circle, and the center is O. AC is the diameter of the circle. AC and BD intersect at E. Which point would map onto itself?