Write the ratio 0.1 to 0.2 as a simplified fraction

Answers

Answer 1
1/10: 1/5
the simplified fraction of 0.1 is 1/10
the simplified fraction of 0.2 is 1/5

Related Questions

Evaluate the expression 2y + 10 + y2 of y=8

Answers

The evaluation of the expression 2y + 10 + y² at y = 8 returns 90 as its value.

How to evaluate a given mathematical expression with variables if values of the variables are known?

You can simply replace those variables with the value you know of them and then operate on those values to get a final value. This is the result of that expression at those values of the considered variables.

The considered expression is 2y + 10 + y²

We need to evaluate it at y = 8

Putting 8 in place of y in the expression, we get:

[tex]2y + 10 + y^2|_{y=8} = 2 \times 8 + 10 + (8)^2 = 16 + 10 + 64 = 90[/tex]

Note that small subscript of y = 8 shows that we're evaluating the expression for y = 8.

Also, when symbols are used with multiplication, we usually hide the multiplication sign and just keep the multiplying quantities close to each other, this is why [tex]2 \times y[/tex] was written 2y in the expression.

Thus, the evaluation of the expression 2y + 10 + y² at y = 8 returns 90 as its value.

Learn more about evaluating a function at a value  here: https://brainly.com/question/2753269

Which of the quadratic functions has the narrowest graph?

Answers

Step-by-step explanation:

The equation with the highest leading coefficient (the number before the x^2 term) will have the narrowest graph. Here, we have to choose between -1, 1/6, 2, and 1/8. The highest number out of all of those numbers is 2, so y = 2x^2 will have the narrowest graph.

What are the abilities needed to to be good in individu the narrow

how do i transform this equation 5(3x+9)-2x=15x-2(x-5)

Answers

You have to multiply to get a simple equation so it would be 15x+45=15x-2x+10 and that’s where my knowledge stops with that

<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3

Let's solve your equation step-by-step.

5 ( 3x + 9 ) − 2x = 15x − 2 ( x − 5 )

Step 1: Simplify both sides of the equation.

5 ( 3x + 9 ) − 2x = 15x − 2 ( x − 5 )

( 5 ) ( 3x ) + ( 5 ) ( 9 ) + −2x = 15x + ( −2 ) ( x ) + ( −2 ) ( −5 ) ( Distribute )

15x + 45 + −2x = 15x + −2x + 10

( 15x + −2x ) + ( 45 ) = ( 15x + −2x ) + ( 10 ) ( Combine Like Terms )

13x + 45 = 13x + 10

13x + 45 = 13x + 10

Step 2: Subtract 13x from both sides.

13x + 45 − 1 3x = 13x + 10 − 13x

45 = 10

Step 3: Subtract 45 from both sides.

45 − 45 = 10 − 45

0 = −35

Answer:

There are no solutions.

<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3

Determine a series of transformations that would map Figure L onto Figure M.
TO
Figure L
Figure M

Answers

Answer:

rotation of 90° counterclockwise, then translation 3 down

The given figure has a rotation of 90° counterclockwise, then translation 3 down.

What is translation?

A translation moves a shape left, right, up, or down without turning it. The translated (or picture) shapes appear to be the same size as the original shape, showing that they are congruent. They've just moved in one or more directions.

The two figures given in the image are plotted on the coordinate plane having axis x and y.

From the figure it is observed that the given figure has a rotation of 90° counterclockwise, then translation 3 down.

Therefore, the given figure has a rotation of 90° counterclockwise, then translation 3 down.

To know more about translation follow

https://brainly.com/question/22817441

#SPJ2

which table shows a relationship between the values of x and y that represents a linear function?

Answers

The second one where 0,0 and 3,1 and 9,9

can two fractions with the same numerator and different denominators be equal ​

Answers

Answer:

No, it cannot be equal

Step-by-step explanation:

For example: 1/2 and 1/4

1/2 represent in 2 pieces you are getting one piece.

1/4 represent in 4 pieces you get one piece

convert 300cm to metre​

Answers

Answer:

3 meters

Step-by-step explanation:

cm to meters is moving decimal to the left 2 times

PLEASE ANSWER ASAP: Two stores offer differently priced sales for the same paper towels, according to the table below. Which store offers the better deal, based on a lower unit price per roll?
PLEASE GIVE STEPS AND ANSWER AND NO FILE LINK!

Answers

Answer:

Store 1.

Step-by-step explanation:

Divide the price by the amount of roles of toilet paper. Ex 3.60÷12=.3 and 3.50÷10=.35. Now choose the lower option

g An airplane is flying overhead at a constant elevation of 4000 ft. A man is viewing the plane from a position 3000 ft from the base of a radio tower. The airplane is flying horizontally away from the man. If the plane is flying at a rate of 600 ft/s, at what rate is the distance between the man and the plane increasing when the plane passes over the radio tower

Answers

Answer:

A man is viewing the plane from a position. 3000 ft from the base of a radio tower. The airplane is flying horizontally away from the man. If the plane is flying at the rate of 600 ft/sec, at what rate is the distance between ...

find the missing measurements in the shape ​

Answers

3, 2
From left to right

Answer:

the area is 30 m2

Step-by-step explanation:

tell weather the ordered pair is a solution of the equation y=7x;(2,21)

Answers

Answer:

3,21 is

2,21 is not a proper ordered pair.

Step-by-step explanation:

Remark

It's not a solution

You can either use the x value to find out the proper y value

or

You can use the y value to find out the proper x value

Proper y value

Let x = 2

y = 7*2

y = 14

So the proper y value given that x = 2 is 14.

Proper x value

Let y = 21

21 = 7x                    Divide both sides by 7

21/7 = 7x/7

3 = x

But (2,21) is not a solution. (3,21) is.

Can someone help me with 6? And 8 I posted

Answers

Answer:

I answered 6 already. I don't now what 7 means though sorry

Step-by-step explanation:

All other things being equal, by how much will nominal GDP expand if the central bank increases the money supply by $100 billion, and the velocity of money is 3?

Answers

If the central bank increases the money supply by $100 billion and the velocity of money by 3, then the nominal GDP will increase by $300 billion.

Mark brainlist plz

The value of nominal GDP, when the central bank increases the money supply by $100 billion, and the velocity of money is 3, is 300.

What is the equation of exchange?

The equation of exchange can be given as,

[tex]M\times V=P\times Q[/tex]

Here, (M) is the money supplied, (V) is the velocity of the money, (P) is level of price and (Q) is Real GDP.

The central bank increases the money supply by $100 billion, and the velocity of money is 3. Here, we have,

[tex]M=300\\V=3[/tex]

The product of level of price and Real GDP is nominal GDP.

[tex]M\times V=P\times Q\\100\times 3=\text{Nominal GDP}\\\text{Nominal GDP}=300[/tex]

Thus, the value of nominal GDP, when the central bank increases the money supply by $100 billion, and the velocity of money is 3, is 300.

Learn more about the nominal GDP here;

https://brainly.com/question/12291963

If Leila continue to eat 8 chips an hour will they ever eat the same amount of chips at the same
time? Explain your reasoning.

Answers

Answer:

Step-by-step explanation:

The variable x varies directly as y and x varies inversely as z. What is the value is y when x=20 and z=-2, if y=30 when z=3 and x=5?

Answers

Answer:

Y=-80

Step-by-step explanation:

X=Ky/z

5=30k/3

30k=15

K=1/2

20=Ky/(-2)

Ky =-40

1/2y=-40

Y=-80

I will increase your salary from $12,000 to $15,000. What is the percentage increase

Answers

Answer:

i think 20%

Step-by-step explanation:

The percent increase of the salary is 25%.

We have,

the salary increases from $12,000 to $15,000

So, Change in Amount= (15,000 - 12,000)

= 3, 000

Now, Percent increase = change in amount/ original amount x 100

= 3000/ 12000 x 100

= 1/4 x 100

= 100/4

= 25%

Thus, the percent increase is 25%.

Learn more about Percent Increase here:

https://brainly.com/question/25098379

#SPJ6

There are 20 pieces of fruit in a bowl and 5 of them are apples. What percent of the fruit are apples?

Answers

Answer:  25%

Step-by-step explanation:

Total pieces=20

apple pieces=5

 =apple pieces/total pieces

=  5/20

for %age multipilying with 100

= 0.25×100

=25 percent

Function f(x) has a jump discontinuity at x = 8. Which statement identifies possible one-sided limits at x = 8?
lim flx) DNE and lim f(x) DNE
lim f(x) DNE and lim Flx) = 120
lim flx) = 85 and lim f(x) = 85
*-37
lim Flx) = 85 and lim flx) = 120
O

Answers

Answer:

D

Step-by-step explanation:

EDGE 2021

The limit of the given functions f(x)=85 and lim f(x)=120.

If any of the following conditions are met, a function is said to be discontinuous:

The function at x = a has left- and right-hand bounds, but they are not equal.The function at x = a has a left-hand limit and a right-hand limit that exist, are equal, but are not equal to f(a).

We have given that,

Function f(x) has a jump discontinuity at x = 8.

We have to determine a statement that identifies possible one-sided limits at x = 8.

Then, lim f(x)=85 and lim f(x)=120

learn more about limit here:

brainly.com/question/26867415

#SPJ7

lI need help please answer​

Answers

What all of them and if u need all of them give me a second

Answer:

Look Below

Step-by-step explanation:

1) 81 = 729/9

2) 36 / 3 = 12

3) 4X = 20 (X = 5)

4) 34 = 176 ???

5) 1470/35 = 42

6) 1 = 2/2

7) 7X = 245 (X = 35)

8) 600X = 2400 (X = 4)

9) 936 = 78X (X = 12)

If you find any fault in my answers please let me know! About 4 I am not able to answer that because I don't see what the problem is asking. Sorry. I hope this helps! Have a good day!

I need help with 7-9 please

Answers

9514 1404 393

Answer:

  7.  4 cm

  8.  206 paper cups

  9.  175pi cm³

Step-by-step explanation:

7. The formula for the volume of a cone can be used.

  V = 1/3πr²h

  h = 3V/(πr²) = 3(48π cm³)/(π(6 cm)²) = 144/36 cm = 4 cm

The height of the cone is 4 cm.

__

8. The volume of the cone with the given dimensions is ...

  V = 1/3π(4 cm)²(11 cm) = 176/3π cm³ ≈ 184.307 cm³

The number of times this volume can be filled by 10 gallons is ...

  (10 gal)(3785 cm³/gal)/(184.307 cm³/cup) = 205.3 cups

206 paper cups are needed.

__

9. We know from the formula for the volume of a cone that it has the same volume as a cylinder 1/3 its height. The composite figure is equivalent to a cylinder with a height of ...

  3 cm +(12 cm)/3 = 7 cm

Then the volume is ...

  V = πr²h

  V = π(5 cm)²(7 cm) = 175π cm³

__

For this, we recognize that the triangle with sides h, 5, and 13 will be a 5-12-13 right triangle, so the height of the conical part of the figure is h=12 cm. If you haven't remembered that Pythagorean triple, you can find the height from the Pythagorean theorem:

  h² +5² = 13²

  h = √(169 -25) = √144 = 12

Been stuck on this all day!! Helppp

Answers

Answer:

Step-by-step explanation:

You have to use the arithmetic sequence

f(n)=f(n-1)+d

You can plug in (40,10) and (50,20)

(10)=f(1)+39d

(20)=f(1)+19d

subtract

-10=20d divide

d=-1/2

plug into one of the equations above

(10)=f(1)+39(-1/2)

10=f(1)-39/2

59/2=f(1)

f(1)=29.5

plug into formula

f(n)=29.5-1/2(n-1)

f(n)= -1/2n +30 final equation (Plug in the table values into "n") to solve

Answer:

if it was like that wouldnt it go from 10 to 20 to 30 to 40 ect.

Step-by-step explanation:

] 1) Convert the number 2,371,875,908 to scientific notation.

Answers

Answer:

2.3718759×10^9

Step-by-step explanation:

Its the answer

Answer:

2.371875908 × 109 is ur answer.

Step-by-step explanation:

hope this helps!

~mina

Help please will mark brainliest!!!

Answers

Answer:

945

Step-by-step explanation:

Aunt Rebecca is pricing cakes for a baby shower she is throwing. She wants one large cake shaped like a duckling and also some cupcakes in pastel colors. Winchester Bakery charges $4 for each cupcake, plus $30 for the large cake. Linda's Sweet Shoppe charges $40 for the large cake and $2 for each cupcake. If Aunt Rebecca orders a certain number of cupcakes, the cost will be the same at either bakery. What would the total cost be?

Answers

Answer:

Yes

Step-by-step explanation

13/12=1 1/12

The mean price for used cars is $10,550. A manager of a Kansas City used car dealership reviewed a sample of 50 recent used car sales at the dealership in an attempt to determine whether the population mean price for used cars at this particular dealership differed from the national mean. The prices for the sample of 50 cars are contained in the Excel Online file below. Construct a spreadsheet to answer the following questions.
a. Formulate the hypotheses that can be used to determine whether a difference exists in the mean price for used cars at the dealership.
b. What is the p-value?
c. At αα= .05, what is your conclusion?

Answers

Answer:

go to algebra answers.com

Step-by-step explanation:

what is the rule for (f - g) (x)?

Answers

Answer:

where is the question check well please

Simplify please
(n^11)^2

Answers

Answer:

n^22 (I love your profile picture by the way)

Step-by-step explanation:

Answer:

n^22

Step-by-nstep explanation:

because you would multiply the exponents so 11 x 2 is n^22

What is the volume of the cube of 3.1 m?

Answers

Answer:

21.79 idrk good luck sbnsjsnsjsnsjznsnz xnddn

Answer:

V = A3 i believe im not at explaining stuff ;^;

Find the area of the triangle below.

Answers

Answer:

the area of this triangle is 5

Answer:

A = 5

Step-by-step explanation:

Solve

The area A of a triangle is given by the Formula; A = 1/2bh where b is the base and h is the height of the triangle.

Solution

A= hbb /2 =2·5/  2=5

Please explain how you find the slope of a graph?

Answers

Answer

m=rise/run

Step-by-step explanation:

To find the slope of a graph, you have to figure out home it is rising and how much it is running. Make sure you know which way is negative and positive. Then you divide rise by run.

Answer:

change in y / change in x

or you could differentiate the function of the graph to find the slope

Step-by-step explanation:

Other Questions
PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible. Consider the linear equation. 5x+6y=15 Which point represents a solution to the equation? Is there a closed economy? A, B, C and D are points on the circumference of a circle, and the center is O. AC is the diameter of the circle. AC and BD intersect at E. Which point would map onto itself?